ret kinase mutant inhibitory activity Search Results


96
R&D Systems rapamycin
FIG. 3. <t>Rapamycin</t> blocks BrdUrd incorporation induced by SCF in spermatogonia. Isolated mouse spermatogonial cells were collected after differentially plating and cultured on serum-coated cover slides in serum-free Ham’s F-12. Cells were untreated or pretreated with 50 nM rapamycin (Rap) for 30 min, and then 100 ng/ml mSCF (R&D Systems, Inc.) and 30 mg/ml BrdUrd (Sigma) were added to the medium. Cells were fixed 18 h later and immunostained with biotiny- lated anti-BrdUrd and streptavidin-peroxidase and 3,39-diaminobenzi- dine (DAB) (Zymed Laboratories Inc.). Data represent mean 6 S.D. of three samples. This is a representative experiment performed inde- pendently twice.
Rapamycin, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rapamycin/product/R&D Systems
Average 96 stars, based on 1 article reviews
rapamycin - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

99
Thermo Fisher gene exp cdkn1b hs00153277 m1
SKP2 is a FASN target in human HCC cell lines. ( A ) The HLF, MHCC97-H, Hep3B, HuH7, and SNU449 cell lines were subjected to FASN knockdown using a specific small interfering siRNA against FASN (si-FASN). Data were collected 48 h after the silencing. The effects of FASN silencing on FASN, SKP2, and <t>p27</t> <t>KIP1</t> <t>protein</t> levels were detected by Western blot analysis. β-Actin was used as a loading control. ( B ) The effects of FASN silencing in the same cell lines on FASN , SKP2 , and <t>CDKN1B</t> (encoding p27 KIP1 ) mRNA levels were detected by quantitative real-time PCR. Student’s t -test: p < 0.0001 *** vs. scramble siRNA (Scr). Experiments were conducted three times in triplicate.
Gene Exp Cdkn1b Hs00153277 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp cdkn1b hs00153277 m1/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
gene exp cdkn1b hs00153277 m1 - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology p16 ink4a
Disruption of Gadd45a abolishes p38 activation after H-ras overexpression. (A) wt and Gadd45a−/− MEF were infected with H-ras-expressing retrovirus, and activities of ERK, JNK, and p38 were analyzed, with MBP, GST-Jun, and GST-ATF2 as substrates, respectively. puro, puromycin. (B) At the same time that the protein extracts were obtained, the levels of <t>p16/Ink4a,</t> p53, and p21/Waf1 were determined. (C) MEF were infected with either puromycin- or H-ras-expressing retroviruses, and 5 days after selection with puromycin, mRNA was purified and the levels of p53-inducible genes (those encoding p21/Waf1, XPC, and ATF2) were analyzed by using a quantitative filter hybridization procedure (29). The relative induction ratio was obtained after dividing the relative level of mRNA after infection with H-ras retrovirus by the level of mRNA after infection with puromycin vector alone. (D) The levels of Gadd45a and p19/ARF mRNA in wt and Gadd45a−/− MEF on day 5 after retroviral infection were measured by Northern blotting. GAPD was included as a loading control.
P16 Ink4a, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/p16 ink4a/product/Santa Cruz Biotechnology
Average 96 stars, based on 1 article reviews
p16 ink4a - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

97
Cell Signaling Technology Inc mek 1 2 inhibitor u0126
Cells were treated with doses of 10 ng/ml FGF2, 1 μM PD-173074, and 10 μM <t>U0126.</t> (A) Western blot for phosphorylated and total Erk. Differentiation markers after 72-hour TβRIII knockdown and rescue with nontargeted shRNA or shRNA against TβRIII, with or without 1 ng/ml FGF2 treatment (gray bars). Densitometry for pErk normalized to total Erk is shown as percent control. 5Y cells were transduced for 96 hours. Quantification of densitometry from 4 independent experiments is shown (normalized mean ± SEM). P < 0.001 for main effect receptor (2-way ANOVA); P < 0.0001 for main effect FGF2 (2-way ANOVA); interaction P < 0.05. (B) Western blots following 96 hours of TβRIII transduction and treatment. Densitometry for NF160 normalized to β-actin is shown as percent control. (C) Western blots following 96 hours of transduction with TβRIII or GFP control and dominant-negative FGFR1 (dnFGFR1) or IRES-GFP vector control. GFP fluorescence was used to verify construct expression. Densitometry for NF160 normalized to β-actin is shown as percent control.
Mek 1 2 Inhibitor U0126, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mek 1 2 inhibitor u0126/product/Cell Signaling Technology Inc
Average 97 stars, based on 1 article reviews
mek 1 2 inhibitor u0126 - by Bioz Stars, 2026-03
97/100 stars
  Buy from Supplier

93
Addgene inc ha gsk3 beta k183q pcdna3
( A ) Scatter plot showing cardiac hypertrophy, as measured by Heart weight/Tibia Length (HW/TL) ratio of 8 weeks old 129/Sv mice treated with either vehicle or isoproterenol (ISO) at the dose of 10 mg/kg/day. ISO was continuously infused for 7 days using osmotic mini-pumps. n = 9–10 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. ( B ) Scatter plot representing left ventricular posterior wall thickness of 8 weeks old 129/Sv mice treated with either vehicle or ISO at the dose of 10 mg/kg/day. ISO was continuously infused for 7 days using osmotic mini-pumps. n = 6 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. ( C ) Scatter plot indicating the contractile functions of heart as represented by ejection fraction of 8 weeks old 129/Sv mice treated with either vehicle or ISO at the dose of 10 mg/kg/day. ISO was continuously infused for 7 days using osmotic mini-pumps. n = 6 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. ( D ) Histogram showing GSK3β activity assay in heart lysates of vehicle or ISO-treated 8 weeks old 129/Sv mice. Mice were treated with either vehicle or ISO at the dose of 10 mg/kg/day for 7 days using osmotic mini-pumps. GSK3β was immunoprecipitated from the heart lysates of vehicle or ISO infused mice using anti-GSK3β antibody, clone GSK-4B (Sigma). The immunoprecipitated GSK3β was incubated with the peptide substrate in the presence of γ− 32 P-ATP. The incorporation of 32 P into the GSK3β peptide substrate, which contains specific phosphorylation residues of GSK3β was measured. n = 10 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. ( E ) Eight weeks old 129/Sv mice were treated with either vehicle or ISO at the dose of 10 mg/kg/day for 7 days using osmotic mini-pumps. GSK3β was immunoprecipitated from the heart lysates of vehicle or ISO infused mice using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnolgy) and the affinity resin immobilized with protein A/G. Western blotting analysis was performed to detect the levels of GSK3β acetylation (Ac-Lys) by anti-acetyl-lysine antibody. IgG was used as negative control in this assay. Heart tissue lysates (WCL) were probed for indicated proteins by western blotting. ANP was used as a positive control to assess cardiac hypertrophy in ISO infused mice. n = 4 mice per group. # marked western blotting images denotes SIRT2 antibody (#12650; Cell Signaling), used in this assay detects single band. ( F ) Histogram showing relative acetylated GSK3β in vehicle and ISO-treated mice heart tissues, as measured from . Signal intensities of acetylated GSK3β and GSK3β were measured by densitometry analysis (ImageJ software). n = 4 mice per group. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( G ) GSK3β was immunoprecipitated from heart tissues of 8 weeks old 129/Sv mice using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnology), and the affinity resin with protein A/G immobilized. Western blotting was performed to detect GSK3β interaction with p300 using anti-p300 antibody. IgG was used as a negative control. Whole cell lysates (WCL) were probed for the presence of GSK3β and p300 by western blotting. ( H ) Co-localization of GSK3β with p300 was assessed in 293 T cells by confocal microscopy. The antibodies used are anti-GSK3β (sc-9166, Santacruz), and p300 (05–257, Millipore). DAPI was used to stain the nucleus. Expanded images (right small boxes) show yellow color in the merge image, indicating the co-localization of GSK3β (Green) and p300 (Red) in the nucleus. ( I ) In vitro binding assay to test the direct interaction between GSK3β and p300. Recombinant p300 (Millipore # 2273152) was incubated with recombinant GST or GST-GSK3β, purified from E. coli BL21 (DE3) by affinity chromatography using Glutathione Sepharose 4B. ( J ) Western blotting analysis showing the acetylation and activity of GSK3β in rat neonatal cardiomyocytes infected with adenovirus expressing either luciferase shRNA (control) or p300 shRNA (p300-KD) for 72 hr. Depletion of p300 was confirmed by western blotting. GSK3β was immunoprecipitated from control and p300-KD cells using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnology) and the affinity resin immobilized with protein A/G. Western blotting was performed to detect acetylation of GSK3β using the anti Ac-Lysine antibody. GSK3β activity was measured by assessing the phosphorylation of glycogen synthase (p–GS). Site-specific antibodies were used to detect the phosphorylation of GSK3β at indicated residues in cardiomyocyte lysates (WCL). ( K ) Histogram showing the quantification of relative acetylated GSK3β in control and p300 depleted (p300-KD) rat neonatal cardiomyocytes, as measured from . Rat neonatal cardiomyocytes were infected with adenovirus expressing either luciferase shRNA (control) or p300 shRNA (p300-KD) for 72 hr. Signal intensities of acetylated GSK3β and GSK3β were quantified by densitometry analysis (ImageJ software). n = 3 independent experiments. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( L ) Histogram depicting the activity of GSK3β in control and p300 depleted (p300-KD) rat neonatal cardiomyocytes, as measured by the ratio of phosphorylation of glycogen synthase vs total glycogen synthase from . Rat neonatal cardiomyocytes were infected with adenovirus expressing either luciferase shRNA (control) or p300 shRNA (p300-KD) for 72 hr. Signal intensities of phospho-glycogen synthase and glycogen synthase were measured by densitometry analysis (ImageJ software). n = 3 independent experiments. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( M ) Western blotting analysis showing the acetylation of GSK3β in rat neonatal cardiomyocytes infected with either control (Ad-null) or p300 overexpressing adenovirus (Ad-p300) for 24 hr. Overexpression of p300 was confirmed by western blotting. GSK3β was immunoprecipitated using anti-GSK3β antibody (sc-9166, Santacruz) and the affinity resin with protein A/G immobilized. Site-specific antibodies were used to detect the phosphorylation of GSK3β at indicated residues in cell lysates (WCL). ( N ) Western blotting analysis showing the activity of GSK3β in rat neonatal cardiomyocytes infected with control (Ad-null) or p300 expressing adenovirus (Ad-p300) for 24 hr. Overexpression of p300 was confirmed by western blotting and the activity of GSK3β was probed by assessing the levels of p-GS and GS by western blotting. ( O ) Histogram showing the activity of GSK3β in control (Ad-Null) or p300 overexpressing (Ad-p300) rat neonatal cardiomyocytes, as measured by the ratio of phosphorylation of glycogen synthase vs total glycogen synthase from . Signal intensities of phospho-glycogen synthase and glycogen synthase were assessed by densitometry analysis (ImageJ software). n = 3 independent experiments. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( P ) In vitro kinase assay showing the activity of acetylated and non-acetylated GSK3β. Human GSK3β with HA tag was overexpressed in HeLa cells by transfection of the plasmid <t>pcDNA3-HA-GSK3β.</t> HA-GSK3β was immunoprecipitated using HA-coupled agarose beads (Sigma-Aldrich) and the HA-GSK3β was acetylated by recombinant p300 (Millipore), in the presence or absence of Acetyl-CoA (Ac-CoA) in HAT buffer. The enzymatic activity of GSK3β was measured against glycogen synthase (GS)-peptide. n = 6 independent experiments. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values.
Ha Gsk3 Beta K183q Pcdna3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ha gsk3 beta k183q pcdna3/product/Addgene inc
Average 93 stars, based on 1 article reviews
ha gsk3 beta k183q pcdna3 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
Millipore ret kinase mutant containing a n-terminally gst-tagged ret kinase domain
( A ) Scatter plot showing cardiac hypertrophy, as measured by Heart weight/Tibia Length (HW/TL) ratio of 8 weeks old 129/Sv mice treated with either vehicle or isoproterenol (ISO) at the dose of 10 mg/kg/day. ISO was continuously infused for 7 days using osmotic mini-pumps. n = 9–10 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. ( B ) Scatter plot representing left ventricular posterior wall thickness of 8 weeks old 129/Sv mice treated with either vehicle or ISO at the dose of 10 mg/kg/day. ISO was continuously infused for 7 days using osmotic mini-pumps. n = 6 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. ( C ) Scatter plot indicating the contractile functions of heart as represented by ejection fraction of 8 weeks old 129/Sv mice treated with either vehicle or ISO at the dose of 10 mg/kg/day. ISO was continuously infused for 7 days using osmotic mini-pumps. n = 6 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. ( D ) Histogram showing GSK3β activity assay in heart lysates of vehicle or ISO-treated 8 weeks old 129/Sv mice. Mice were treated with either vehicle or ISO at the dose of 10 mg/kg/day for 7 days using osmotic mini-pumps. GSK3β was immunoprecipitated from the heart lysates of vehicle or ISO infused mice using anti-GSK3β antibody, clone GSK-4B (Sigma). The immunoprecipitated GSK3β was incubated with the peptide substrate in the presence of γ− 32 P-ATP. The incorporation of 32 P into the GSK3β peptide substrate, which contains specific phosphorylation residues of GSK3β was measured. n = 10 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. ( E ) Eight weeks old 129/Sv mice were treated with either vehicle or ISO at the dose of 10 mg/kg/day for 7 days using osmotic mini-pumps. GSK3β was immunoprecipitated from the heart lysates of vehicle or ISO infused mice using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnolgy) and the affinity resin immobilized with protein A/G. Western blotting analysis was performed to detect the levels of GSK3β acetylation (Ac-Lys) by anti-acetyl-lysine antibody. IgG was used as negative control in this assay. Heart tissue lysates (WCL) were probed for indicated proteins by western blotting. ANP was used as a positive control to assess cardiac hypertrophy in ISO infused mice. n = 4 mice per group. # marked western blotting images denotes SIRT2 antibody (#12650; Cell Signaling), used in this assay detects single band. ( F ) Histogram showing relative acetylated GSK3β in vehicle and ISO-treated mice heart tissues, as measured from . Signal intensities of acetylated GSK3β and GSK3β were measured by densitometry analysis (ImageJ software). n = 4 mice per group. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( G ) GSK3β was immunoprecipitated from heart tissues of 8 weeks old 129/Sv mice using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnology), and the affinity resin with protein A/G immobilized. Western blotting was performed to detect GSK3β interaction with p300 using anti-p300 antibody. IgG was used as a negative control. Whole cell lysates (WCL) were probed for the presence of GSK3β and p300 by western blotting. ( H ) Co-localization of GSK3β with p300 was assessed in 293 T cells by confocal microscopy. The antibodies used are anti-GSK3β (sc-9166, Santacruz), and p300 (05–257, Millipore). DAPI was used to stain the nucleus. Expanded images (right small boxes) show yellow color in the merge image, indicating the co-localization of GSK3β (Green) and p300 (Red) in the nucleus. ( I ) In vitro binding assay to test the direct interaction between GSK3β and p300. Recombinant p300 (Millipore # 2273152) was incubated with recombinant GST or GST-GSK3β, purified from E. coli BL21 (DE3) by affinity chromatography using Glutathione Sepharose 4B. ( J ) Western blotting analysis showing the acetylation and activity of GSK3β in rat neonatal cardiomyocytes infected with adenovirus expressing either luciferase shRNA (control) or p300 shRNA (p300-KD) for 72 hr. Depletion of p300 was confirmed by western blotting. GSK3β was immunoprecipitated from control and p300-KD cells using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnology) and the affinity resin immobilized with protein A/G. Western blotting was performed to detect acetylation of GSK3β using the anti Ac-Lysine antibody. GSK3β activity was measured by assessing the phosphorylation of glycogen synthase (p–GS). Site-specific antibodies were used to detect the phosphorylation of GSK3β at indicated residues in cardiomyocyte lysates (WCL). ( K ) Histogram showing the quantification of relative acetylated GSK3β in control and p300 depleted (p300-KD) rat neonatal cardiomyocytes, as measured from . Rat neonatal cardiomyocytes were infected with adenovirus expressing either luciferase shRNA (control) or p300 shRNA (p300-KD) for 72 hr. Signal intensities of acetylated GSK3β and GSK3β were quantified by densitometry analysis (ImageJ software). n = 3 independent experiments. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( L ) Histogram depicting the activity of GSK3β in control and p300 depleted (p300-KD) rat neonatal cardiomyocytes, as measured by the ratio of phosphorylation of glycogen synthase vs total glycogen synthase from . Rat neonatal cardiomyocytes were infected with adenovirus expressing either luciferase shRNA (control) or p300 shRNA (p300-KD) for 72 hr. Signal intensities of phospho-glycogen synthase and glycogen synthase were measured by densitometry analysis (ImageJ software). n = 3 independent experiments. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( M ) Western blotting analysis showing the acetylation of GSK3β in rat neonatal cardiomyocytes infected with either control (Ad-null) or p300 overexpressing adenovirus (Ad-p300) for 24 hr. Overexpression of p300 was confirmed by western blotting. GSK3β was immunoprecipitated using anti-GSK3β antibody (sc-9166, Santacruz) and the affinity resin with protein A/G immobilized. Site-specific antibodies were used to detect the phosphorylation of GSK3β at indicated residues in cell lysates (WCL). ( N ) Western blotting analysis showing the activity of GSK3β in rat neonatal cardiomyocytes infected with control (Ad-null) or p300 expressing adenovirus (Ad-p300) for 24 hr. Overexpression of p300 was confirmed by western blotting and the activity of GSK3β was probed by assessing the levels of p-GS and GS by western blotting. ( O ) Histogram showing the activity of GSK3β in control (Ad-Null) or p300 overexpressing (Ad-p300) rat neonatal cardiomyocytes, as measured by the ratio of phosphorylation of glycogen synthase vs total glycogen synthase from . Signal intensities of phospho-glycogen synthase and glycogen synthase were assessed by densitometry analysis (ImageJ software). n = 3 independent experiments. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( P ) In vitro kinase assay showing the activity of acetylated and non-acetylated GSK3β. Human GSK3β with HA tag was overexpressed in HeLa cells by transfection of the plasmid <t>pcDNA3-HA-GSK3β.</t> HA-GSK3β was immunoprecipitated using HA-coupled agarose beads (Sigma-Aldrich) and the HA-GSK3β was acetylated by recombinant p300 (Millipore), in the presence or absence of Acetyl-CoA (Ac-CoA) in HAT buffer. The enzymatic activity of GSK3β was measured against glycogen synthase (GS)-peptide. n = 6 independent experiments. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values.
Ret Kinase Mutant Containing A N Terminally Gst Tagged Ret Kinase Domain, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ret kinase mutant containing a n-terminally gst-tagged ret kinase domain/product/Millipore
Average 90 stars, based on 1 article reviews
ret kinase mutant containing a n-terminally gst-tagged ret kinase domain - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Agenus Inc vemurafenib
( A ) Scatter plot showing cardiac hypertrophy, as measured by Heart weight/Tibia Length (HW/TL) ratio of 8 weeks old 129/Sv mice treated with either vehicle or isoproterenol (ISO) at the dose of 10 mg/kg/day. ISO was continuously infused for 7 days using osmotic mini-pumps. n = 9–10 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. ( B ) Scatter plot representing left ventricular posterior wall thickness of 8 weeks old 129/Sv mice treated with either vehicle or ISO at the dose of 10 mg/kg/day. ISO was continuously infused for 7 days using osmotic mini-pumps. n = 6 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. ( C ) Scatter plot indicating the contractile functions of heart as represented by ejection fraction of 8 weeks old 129/Sv mice treated with either vehicle or ISO at the dose of 10 mg/kg/day. ISO was continuously infused for 7 days using osmotic mini-pumps. n = 6 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. ( D ) Histogram showing GSK3β activity assay in heart lysates of vehicle or ISO-treated 8 weeks old 129/Sv mice. Mice were treated with either vehicle or ISO at the dose of 10 mg/kg/day for 7 days using osmotic mini-pumps. GSK3β was immunoprecipitated from the heart lysates of vehicle or ISO infused mice using anti-GSK3β antibody, clone GSK-4B (Sigma). The immunoprecipitated GSK3β was incubated with the peptide substrate in the presence of γ− 32 P-ATP. The incorporation of 32 P into the GSK3β peptide substrate, which contains specific phosphorylation residues of GSK3β was measured. n = 10 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. ( E ) Eight weeks old 129/Sv mice were treated with either vehicle or ISO at the dose of 10 mg/kg/day for 7 days using osmotic mini-pumps. GSK3β was immunoprecipitated from the heart lysates of vehicle or ISO infused mice using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnolgy) and the affinity resin immobilized with protein A/G. Western blotting analysis was performed to detect the levels of GSK3β acetylation (Ac-Lys) by anti-acetyl-lysine antibody. IgG was used as negative control in this assay. Heart tissue lysates (WCL) were probed for indicated proteins by western blotting. ANP was used as a positive control to assess cardiac hypertrophy in ISO infused mice. n = 4 mice per group. # marked western blotting images denotes SIRT2 antibody (#12650; Cell Signaling), used in this assay detects single band. ( F ) Histogram showing relative acetylated GSK3β in vehicle and ISO-treated mice heart tissues, as measured from . Signal intensities of acetylated GSK3β and GSK3β were measured by densitometry analysis (ImageJ software). n = 4 mice per group. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( G ) GSK3β was immunoprecipitated from heart tissues of 8 weeks old 129/Sv mice using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnology), and the affinity resin with protein A/G immobilized. Western blotting was performed to detect GSK3β interaction with p300 using anti-p300 antibody. IgG was used as a negative control. Whole cell lysates (WCL) were probed for the presence of GSK3β and p300 by western blotting. ( H ) Co-localization of GSK3β with p300 was assessed in 293 T cells by confocal microscopy. The antibodies used are anti-GSK3β (sc-9166, Santacruz), and p300 (05–257, Millipore). DAPI was used to stain the nucleus. Expanded images (right small boxes) show yellow color in the merge image, indicating the co-localization of GSK3β (Green) and p300 (Red) in the nucleus. ( I ) In vitro binding assay to test the direct interaction between GSK3β and p300. Recombinant p300 (Millipore # 2273152) was incubated with recombinant GST or GST-GSK3β, purified from E. coli BL21 (DE3) by affinity chromatography using Glutathione Sepharose 4B. ( J ) Western blotting analysis showing the acetylation and activity of GSK3β in rat neonatal cardiomyocytes infected with adenovirus expressing either luciferase shRNA (control) or p300 shRNA (p300-KD) for 72 hr. Depletion of p300 was confirmed by western blotting. GSK3β was immunoprecipitated from control and p300-KD cells using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnology) and the affinity resin immobilized with protein A/G. Western blotting was performed to detect acetylation of GSK3β using the anti Ac-Lysine antibody. GSK3β activity was measured by assessing the phosphorylation of glycogen synthase (p–GS). Site-specific antibodies were used to detect the phosphorylation of GSK3β at indicated residues in cardiomyocyte lysates (WCL). ( K ) Histogram showing the quantification of relative acetylated GSK3β in control and p300 depleted (p300-KD) rat neonatal cardiomyocytes, as measured from . Rat neonatal cardiomyocytes were infected with adenovirus expressing either luciferase shRNA (control) or p300 shRNA (p300-KD) for 72 hr. Signal intensities of acetylated GSK3β and GSK3β were quantified by densitometry analysis (ImageJ software). n = 3 independent experiments. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( L ) Histogram depicting the activity of GSK3β in control and p300 depleted (p300-KD) rat neonatal cardiomyocytes, as measured by the ratio of phosphorylation of glycogen synthase vs total glycogen synthase from . Rat neonatal cardiomyocytes were infected with adenovirus expressing either luciferase shRNA (control) or p300 shRNA (p300-KD) for 72 hr. Signal intensities of phospho-glycogen synthase and glycogen synthase were measured by densitometry analysis (ImageJ software). n = 3 independent experiments. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( M ) Western blotting analysis showing the acetylation of GSK3β in rat neonatal cardiomyocytes infected with either control (Ad-null) or p300 overexpressing adenovirus (Ad-p300) for 24 hr. Overexpression of p300 was confirmed by western blotting. GSK3β was immunoprecipitated using anti-GSK3β antibody (sc-9166, Santacruz) and the affinity resin with protein A/G immobilized. Site-specific antibodies were used to detect the phosphorylation of GSK3β at indicated residues in cell lysates (WCL). ( N ) Western blotting analysis showing the activity of GSK3β in rat neonatal cardiomyocytes infected with control (Ad-null) or p300 expressing adenovirus (Ad-p300) for 24 hr. Overexpression of p300 was confirmed by western blotting and the activity of GSK3β was probed by assessing the levels of p-GS and GS by western blotting. ( O ) Histogram showing the activity of GSK3β in control (Ad-Null) or p300 overexpressing (Ad-p300) rat neonatal cardiomyocytes, as measured by the ratio of phosphorylation of glycogen synthase vs total glycogen synthase from . Signal intensities of phospho-glycogen synthase and glycogen synthase were assessed by densitometry analysis (ImageJ software). n = 3 independent experiments. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( P ) In vitro kinase assay showing the activity of acetylated and non-acetylated GSK3β. Human GSK3β with HA tag was overexpressed in HeLa cells by transfection of the plasmid <t>pcDNA3-HA-GSK3β.</t> HA-GSK3β was immunoprecipitated using HA-coupled agarose beads (Sigma-Aldrich) and the HA-GSK3β was acetylated by recombinant p300 (Millipore), in the presence or absence of Acetyl-CoA (Ac-CoA) in HAT buffer. The enzymatic activity of GSK3β was measured against glycogen synthase (GS)-peptide. n = 6 independent experiments. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values.
Vemurafenib, supplied by Agenus Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/vemurafenib/product/Agenus Inc
Average 90 stars, based on 1 article reviews
vemurafenib - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

93
Thermo Fisher gene exp cdkn1b mm00438168 m1
SKP2 is a FASN target in human HCC cell lines. ( A ) The HLF, MHCC97-H, Hep3B, HuH7, and SNU449 cell lines were subjected to FASN knockdown using a specific small interfering siRNA against FASN (si-FASN). Data were collected 48 h after the silencing. The effects of FASN silencing on FASN, SKP2, and <t>p27</t> <t>KIP1</t> <t>protein</t> levels were detected by Western blot analysis. β-Actin was used as a loading control. ( B ) The effects of FASN silencing in the same cell lines on FASN , SKP2 , and <t>CDKN1B</t> (encoding p27 KIP1 ) mRNA levels were detected by quantitative real-time PCR. Student’s t -test: p < 0.0001 *** vs. scramble siRNA (Scr). Experiments were conducted three times in triplicate.
Gene Exp Cdkn1b Mm00438168 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp cdkn1b mm00438168 m1/product/Thermo Fisher
Average 93 stars, based on 1 article reviews
gene exp cdkn1b mm00438168 m1 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

94
Carna Inc c481s mutant btk inhibitory activity test
SKP2 is a FASN target in human HCC cell lines. ( A ) The HLF, MHCC97-H, Hep3B, HuH7, and SNU449 cell lines were subjected to FASN knockdown using a specific small interfering siRNA against FASN (si-FASN). Data were collected 48 h after the silencing. The effects of FASN silencing on FASN, SKP2, and <t>p27</t> <t>KIP1</t> <t>protein</t> levels were detected by Western blot analysis. β-Actin was used as a loading control. ( B ) The effects of FASN silencing in the same cell lines on FASN , SKP2 , and <t>CDKN1B</t> (encoding p27 KIP1 ) mRNA levels were detected by quantitative real-time PCR. Student’s t -test: p < 0.0001 *** vs. scramble siRNA (Scr). Experiments were conducted three times in triplicate.
C481s Mutant Btk Inhibitory Activity Test, supplied by Carna Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c481s mutant btk inhibitory activity test/product/Carna Inc
Average 94 stars, based on 1 article reviews
c481s mutant btk inhibitory activity test - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

96
Selleck Chemicals jnk
HepG2 cells were treated with applied concentrations of liposomal C8 for indicated time, expressions of indicated proteins were tested Western blots (A). HepG2 cells, pretreated with <t>JNK</t> inhibitor IX (“JNKi”, 0.25 μM) <t>or</t> <t>SP600125</t> (“SP”, 5 μM) for 1 h, were treated with liposomal C8 (10 μM), cell proliferation (B) and apoptosis (C) were tested. Control HepG2 cells, or the stable HepG2 cells expressing dominant negative JNK1 (“dn-JNK1”) or empty vector (pSuper), were treated with liposomal C8 (10 μM) for applied time, Western blots were utilized to test the signaling changes (D), cell proliferation (E) and cell apoptosis (F) were also tested. Control HepG2 cells, as well as stable HepG2 cells expressing scramble control shRNA (“sc-shRNA”) or ASK1-shRNA were treated with liposomal C8 (10 μM) for applied time, signaling changes (G), cell proliferation (H) and apoptosis (I) were tested as described. Expressions of listed proteins were quantified (A, D and G, a total of three repeats). Data represent the means of three independent experiments ± SD. The asterisks (*) indicate statistically significant differences compared to “C” group. # indicates statistically significant differences compared to liposomal C8 only group of “no shRNA” or “Vector” group.
Jnk, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/jnk/product/Selleck Chemicals
Average 96 stars, based on 1 article reviews
jnk - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

90
Mastocytosis Society kit d816v mutation
HepG2 cells were treated with applied concentrations of liposomal C8 for indicated time, expressions of indicated proteins were tested Western blots (A). HepG2 cells, pretreated with <t>JNK</t> inhibitor IX (“JNKi”, 0.25 μM) <t>or</t> <t>SP600125</t> (“SP”, 5 μM) for 1 h, were treated with liposomal C8 (10 μM), cell proliferation (B) and apoptosis (C) were tested. Control HepG2 cells, or the stable HepG2 cells expressing dominant negative JNK1 (“dn-JNK1”) or empty vector (pSuper), were treated with liposomal C8 (10 μM) for applied time, Western blots were utilized to test the signaling changes (D), cell proliferation (E) and cell apoptosis (F) were also tested. Control HepG2 cells, as well as stable HepG2 cells expressing scramble control shRNA (“sc-shRNA”) or ASK1-shRNA were treated with liposomal C8 (10 μM) for applied time, signaling changes (G), cell proliferation (H) and apoptosis (I) were tested as described. Expressions of listed proteins were quantified (A, D and G, a total of three repeats). Data represent the means of three independent experiments ± SD. The asterisks (*) indicate statistically significant differences compared to “C” group. # indicates statistically significant differences compared to liposomal C8 only group of “no shRNA” or “Vector” group.
Kit D816v Mutation, supplied by Mastocytosis Society, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/kit d816v mutation/product/Mastocytosis Society
Average 90 stars, based on 1 article reviews
kit d816v mutation - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

96
Proteintech p16 ink4a
A Crystal violent staining under microscopy of MKN1 NTC cells, ILK knock-out single-cell clone #1 and #18 with SA-β-Gal staining respectively. Scale bar, 50 μm. B F-actin (red)/DAPI (blue) and ZO-1 (green) staining of three selected clones. Scale bar, 25 μm. C The percentage of cells with positive staining for SA-β-Gal from A . D Quantification of F-actin and ZO-1 fluorescent intensity from B . E Flow cytometry analysis of cell size from indicated clones. F Western blot analysis of several cell cycle-related proteins in the lysate of the three clones, with GAPDH as the loading control. G Representative pairs of low power (left, solid line) and high power (right, dotted line) photomicrographs images of xenografic tumors that were subjected to SA-β-Gal, p21, <t>p16,</t> p53 and p-γH2AX staining were shown. Scale bar, 200 μm (solid line), 100 μm (dotted line). Arrows, nucleus-staining zone. H The percentage of cells stained positively in the field for SA-β-Gal, p21, p16, p53, and p-γH2AX were shown by IHC scores. Data represent the mean ± SD of at least three independent experiments. * p < 0.05, ** p < 0.01 and *** p < 0.001.
P16 Ink4a, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/p16 ink4a/product/Proteintech
Average 96 stars, based on 1 article reviews
p16 ink4a - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

Image Search Results


FIG. 3. Rapamycin blocks BrdUrd incorporation induced by SCF in spermatogonia. Isolated mouse spermatogonial cells were collected after differentially plating and cultured on serum-coated cover slides in serum-free Ham’s F-12. Cells were untreated or pretreated with 50 nM rapamycin (Rap) for 30 min, and then 100 ng/ml mSCF (R&D Systems, Inc.) and 30 mg/ml BrdUrd (Sigma) were added to the medium. Cells were fixed 18 h later and immunostained with biotiny- lated anti-BrdUrd and streptavidin-peroxidase and 3,39-diaminobenzi- dine (DAB) (Zymed Laboratories Inc.). Data represent mean 6 S.D. of three samples. This is a representative experiment performed inde- pendently twice.

Journal: Journal of Biological Chemistry

Article Title: Stem Cell Factor/c-kit Up-regulates Cyclin D3 and Promotes Cell Cycle Progression via the Phosphoinositide 3-Kinase/p70 S6 Kinase Pathway in Spermatogonia

doi: 10.1074/jbc.m002218200

Figure Lengend Snippet: FIG. 3. Rapamycin blocks BrdUrd incorporation induced by SCF in spermatogonia. Isolated mouse spermatogonial cells were collected after differentially plating and cultured on serum-coated cover slides in serum-free Ham’s F-12. Cells were untreated or pretreated with 50 nM rapamycin (Rap) for 30 min, and then 100 ng/ml mSCF (R&D Systems, Inc.) and 30 mg/ml BrdUrd (Sigma) were added to the medium. Cells were fixed 18 h later and immunostained with biotiny- lated anti-BrdUrd and streptavidin-peroxidase and 3,39-diaminobenzi- dine (DAB) (Zymed Laboratories Inc.). Data represent mean 6 S.D. of three samples. This is a representative experiment performed inde- pendently twice.

Article Snippet: Isolated spermatogonial cells were cultured in serum-free medium overnight and then the cells were pretreated with 100 nM wortmannin (an inhibitor of PI3-K) or 50 nM rapamycin (an mTOR-dependent inhibitor of p70S6K) for 30 min and then stimulated with 100 ng/ml mSCF (R&D Systems, Inc.) for 45 min or 6 h. 40 mg of protein extracts of treated cells were resolved by SDS-PAGE and blotted with phospho-p70S6K antibodies, including anti-Thr-389 and anti-Thr-421/Ser-424.

Techniques: Isolation, Cell Culture

FIG. 4. SCF/c-kit up-regulates cyclin D3 expression and in- duces phosphorylation of Rb. Isolated mouse spermatogonial cells were cultured in serum-free medium overnight and then switched to fresh medium with 10% serum (lane 2) or without serum (lanes 1, 3–8). After 30 min of pretreatment with 100 nM wortmannin (lanes 5 and 6) or 50 nM rapamycin (lanes 7 and 8), 100 ng/ml mSCF was added to the medium (lanes 3–8). Then, the culture was continued for another 6 h (lanes 3, 5, and 7) or 18 h (lanes 1, 2, 4, 6, and 8). 50 mg of total protein of cells from each culture were resolved by 4–12% SDS-PAGE and immunoblotted (IB) with cyclin D3 antibody (ab), and then the same filter was blotted with antibody to phospho-Rb (Ser-780) and Rb antibody (panel A). The same amount of protein from each sample was resolved by 10% SDS-PAGE and blotted with antibody to b-actin (panel D).

Journal: Journal of Biological Chemistry

Article Title: Stem Cell Factor/c-kit Up-regulates Cyclin D3 and Promotes Cell Cycle Progression via the Phosphoinositide 3-Kinase/p70 S6 Kinase Pathway in Spermatogonia

doi: 10.1074/jbc.m002218200

Figure Lengend Snippet: FIG. 4. SCF/c-kit up-regulates cyclin D3 expression and in- duces phosphorylation of Rb. Isolated mouse spermatogonial cells were cultured in serum-free medium overnight and then switched to fresh medium with 10% serum (lane 2) or without serum (lanes 1, 3–8). After 30 min of pretreatment with 100 nM wortmannin (lanes 5 and 6) or 50 nM rapamycin (lanes 7 and 8), 100 ng/ml mSCF was added to the medium (lanes 3–8). Then, the culture was continued for another 6 h (lanes 3, 5, and 7) or 18 h (lanes 1, 2, 4, 6, and 8). 50 mg of total protein of cells from each culture were resolved by 4–12% SDS-PAGE and immunoblotted (IB) with cyclin D3 antibody (ab), and then the same filter was blotted with antibody to phospho-Rb (Ser-780) and Rb antibody (panel A). The same amount of protein from each sample was resolved by 10% SDS-PAGE and blotted with antibody to b-actin (panel D).

Article Snippet: Isolated spermatogonial cells were cultured in serum-free medium overnight and then the cells were pretreated with 100 nM wortmannin (an inhibitor of PI3-K) or 50 nM rapamycin (an mTOR-dependent inhibitor of p70S6K) for 30 min and then stimulated with 100 ng/ml mSCF (R&D Systems, Inc.) for 45 min or 6 h. 40 mg of protein extracts of treated cells were resolved by SDS-PAGE and blotted with phospho-p70S6K antibodies, including anti-Thr-389 and anti-Thr-421/Ser-424.

Techniques: Expressing, Phospho-proteomics, Isolation, Cell Culture, SDS Page

FIG. 2. SCF induces both wortmannin- and rapamycin-sensi- tive phosphorylation of p70 S6 kinase. Isolated mouse spermato- gonial cells were cultured in serum-free medium overnight; treated with either vehicle (Me2SO), 100 nM wortmannin, or 50 nM rapamycin for 30 min; and then stimulated with 100 ng/ml SCF for 45 min or 6 h. 40 mg of total protein of each culture were resolved by 10% SDS-PAGE and blotted with antibody to phospho-p70S6K (Thr-389) and p70S6K antibody.

Journal: Journal of Biological Chemistry

Article Title: Stem Cell Factor/c-kit Up-regulates Cyclin D3 and Promotes Cell Cycle Progression via the Phosphoinositide 3-Kinase/p70 S6 Kinase Pathway in Spermatogonia

doi: 10.1074/jbc.m002218200

Figure Lengend Snippet: FIG. 2. SCF induces both wortmannin- and rapamycin-sensi- tive phosphorylation of p70 S6 kinase. Isolated mouse spermato- gonial cells were cultured in serum-free medium overnight; treated with either vehicle (Me2SO), 100 nM wortmannin, or 50 nM rapamycin for 30 min; and then stimulated with 100 ng/ml SCF for 45 min or 6 h. 40 mg of total protein of each culture were resolved by 10% SDS-PAGE and blotted with antibody to phospho-p70S6K (Thr-389) and p70S6K antibody.

Article Snippet: Isolated spermatogonial cells were cultured in serum-free medium overnight and then the cells were pretreated with 100 nM wortmannin (an inhibitor of PI3-K) or 50 nM rapamycin (an mTOR-dependent inhibitor of p70S6K) for 30 min and then stimulated with 100 ng/ml mSCF (R&D Systems, Inc.) for 45 min or 6 h. 40 mg of protein extracts of treated cells were resolved by SDS-PAGE and blotted with phospho-p70S6K antibodies, including anti-Thr-389 and anti-Thr-421/Ser-424.

Techniques: Phospho-proteomics, Isolation, Cell Culture, SDS Page

FIG. 6. SCF/c-kit/PI3-K activates p70S6K through AKT. A, iso- lated mouse spermatogonial cells were serum-starved for 8 h and then left untreated or treated with 100 ng/ml mSCF (R&D Systems, Inc.) for 30 min; 50 mg of total protein of each culture were resolved by 10% SDS-PAGE and blotted with antibody to p-AKT (Ser-473) (top panel) and AKT antibody (bottom panel). B, mouse spermatogonial cells were transfected with p70S6K or cotransfected with p70S6K plasmid and constitutively active AKT (pLXSN-v-AKT); after culture for 48 h, 50 nM rapamycin was added to one of the cotransfected cell dishes, all three cultures were serum-starved for 24 h, and then 20 mg of total protein from each culture were resolved by 10% SDS-PAGE and blotted with antibody to p-p70S6K (Thr-389) (top panel) and p70SK antibody (bot- tom panel). C, mouse spermatogonial cells were transfected with p70S6K plasmid or cotransfected with p70S6K plasmid and active p110 of PI3-K alone or together with dominant negative AKT-K179M; after culture for 48 h, cells were serum-starved for 24 h, and then 20 mg of total protein of each culture were resolved by 10% SDS-PAGE and blotted with antibody to p-p70S6K (Thr-389) and p70S6K antibody. The image intensity of phosphorylation of p70S6K was quantitated with the Sigmagel program, normalized by the Western blot signal for p70S6K of each loading, then presented as a bar graph (D).

Journal: Journal of Biological Chemistry

Article Title: Stem Cell Factor/c-kit Up-regulates Cyclin D3 and Promotes Cell Cycle Progression via the Phosphoinositide 3-Kinase/p70 S6 Kinase Pathway in Spermatogonia

doi: 10.1074/jbc.m002218200

Figure Lengend Snippet: FIG. 6. SCF/c-kit/PI3-K activates p70S6K through AKT. A, iso- lated mouse spermatogonial cells were serum-starved for 8 h and then left untreated or treated with 100 ng/ml mSCF (R&D Systems, Inc.) for 30 min; 50 mg of total protein of each culture were resolved by 10% SDS-PAGE and blotted with antibody to p-AKT (Ser-473) (top panel) and AKT antibody (bottom panel). B, mouse spermatogonial cells were transfected with p70S6K or cotransfected with p70S6K plasmid and constitutively active AKT (pLXSN-v-AKT); after culture for 48 h, 50 nM rapamycin was added to one of the cotransfected cell dishes, all three cultures were serum-starved for 24 h, and then 20 mg of total protein from each culture were resolved by 10% SDS-PAGE and blotted with antibody to p-p70S6K (Thr-389) (top panel) and p70SK antibody (bot- tom panel). C, mouse spermatogonial cells were transfected with p70S6K plasmid or cotransfected with p70S6K plasmid and active p110 of PI3-K alone or together with dominant negative AKT-K179M; after culture for 48 h, cells were serum-starved for 24 h, and then 20 mg of total protein of each culture were resolved by 10% SDS-PAGE and blotted with antibody to p-p70S6K (Thr-389) and p70S6K antibody. The image intensity of phosphorylation of p70S6K was quantitated with the Sigmagel program, normalized by the Western blot signal for p70S6K of each loading, then presented as a bar graph (D).

Article Snippet: Isolated spermatogonial cells were cultured in serum-free medium overnight and then the cells were pretreated with 100 nM wortmannin (an inhibitor of PI3-K) or 50 nM rapamycin (an mTOR-dependent inhibitor of p70S6K) for 30 min and then stimulated with 100 ng/ml mSCF (R&D Systems, Inc.) for 45 min or 6 h. 40 mg of protein extracts of treated cells were resolved by SDS-PAGE and blotted with phospho-p70S6K antibodies, including anti-Thr-389 and anti-Thr-421/Ser-424.

Techniques: SDS Page, Transfection, Plasmid Preparation, Dominant Negative Mutation, Phospho-proteomics, Western Blot

SKP2 is a FASN target in human HCC cell lines. ( A ) The HLF, MHCC97-H, Hep3B, HuH7, and SNU449 cell lines were subjected to FASN knockdown using a specific small interfering siRNA against FASN (si-FASN). Data were collected 48 h after the silencing. The effects of FASN silencing on FASN, SKP2, and p27 KIP1 protein levels were detected by Western blot analysis. β-Actin was used as a loading control. ( B ) The effects of FASN silencing in the same cell lines on FASN , SKP2 , and CDKN1B (encoding p27 KIP1 ) mRNA levels were detected by quantitative real-time PCR. Student’s t -test: p < 0.0001 *** vs. scramble siRNA (Scr). Experiments were conducted three times in triplicate.

Journal: Medicina

Article Title: Fatty Acid Synthase Promotes Hepatocellular Carcinoma Growth via S-Phase Kinase-Associated Protein 2/p27 KIP1 Regulation

doi: 10.3390/medicina60071160

Figure Lengend Snippet: SKP2 is a FASN target in human HCC cell lines. ( A ) The HLF, MHCC97-H, Hep3B, HuH7, and SNU449 cell lines were subjected to FASN knockdown using a specific small interfering siRNA against FASN (si-FASN). Data were collected 48 h after the silencing. The effects of FASN silencing on FASN, SKP2, and p27 KIP1 protein levels were detected by Western blot analysis. β-Actin was used as a loading control. ( B ) The effects of FASN silencing in the same cell lines on FASN , SKP2 , and CDKN1B (encoding p27 KIP1 ) mRNA levels were detected by quantitative real-time PCR. Student’s t -test: p < 0.0001 *** vs. scramble siRNA (Scr). Experiments were conducted three times in triplicate.

Article Snippet: Gene Expression Assays for human FASN (Hs01005622_m1), SKP2 (Hs01021864_m1), CDKN1B (Hs00153277_m1), and β-actin (4333762T), and mouse Fasn (Mm00662319_m1), Skp2 (Mm00449925_m1), Cdkn1b (Mm00438168_m1) and β-actin (mm00607939_S1) were from Applied Biosystems (Foster City, CA, USA).

Techniques: Knockdown, Western Blot, Control, Real-time Polymerase Chain Reaction

SKP2 is induced in the liver lesions from AKT mice. ( A , B ) Hydrodynamic gene delivery approach. In brief, FASN fl/fl mice were either injected with the myr-AKT1 construct (AKT mice) ( A ) or co-injected with Myr-AKT1 and Cre recombinase plasmids (AKT/Cre mice) ( B ). Five mice per group were injected and sacrificed 32 weeks post-injection (w.p.i.). ( C ) Immunohistochemical analysis shows that hepatocellular tumor lesions (T) developed in AKT mice display robust immunoreactivity for FASN, HA-AKT, and SKP2 proteins. Note that in the tumor cells, the immunoreactivity for SKP2 is localized in the cytoplasmic and nuclear compartments, as appreciable at the 200× magnification. In contrast, the surrounding non-tumorous liver tissues (ST) show weak/absent staining for the same proteins. Abbreviation: H&E, hematoxylin and eosin staining. Original magnifications: 100× and 200×, as indicated. Scale bar: 100 µm in 100× magnification pictures, 50 µm in the 200× magnification picture. ( D ) Representative Western blot analysis showing the levels of FASN, SKP2, and p27KIP1 in livers from FASN fl/fl mice injected with the empty vector only (Control), Myr-AKT1 (AKT mice), and myr-AKT1/Cre (AKT/Cre mice). Note that AKT mice display upregulation of SKP2 and marked downregulation of p27 KIP1 . Suppression of FASN in AKT/Cre mice, which triggers the inhibition of hepatocarcinogenesis, is accompanied by downregulation of SKP2 and an increase of p27 KIP1 protein levels. β-Actin was used as a loading control. ( E ) Quantitative real-time RT-PCR showing the mRNA levels of Fasn , Skp2 , and Cdkn1b in livers from FASN fl/fl mice injected with the empty vector only (vector), Myr-AKT1 (AKT mice) and myr-AKT1/Cre (AKT/Cre mice). N target = 2 −ΔCt , wherein the ΔCt value of each sample was calculated by subtracting the average Ct value of the target gene from the average Ct value of the β- actin gene. Five mice per group were analyzed. Tukey–Kramer’s test: p < 0.0001; a , versus control livers (vector); b , versus AKT livers.

Journal: Medicina

Article Title: Fatty Acid Synthase Promotes Hepatocellular Carcinoma Growth via S-Phase Kinase-Associated Protein 2/p27 KIP1 Regulation

doi: 10.3390/medicina60071160

Figure Lengend Snippet: SKP2 is induced in the liver lesions from AKT mice. ( A , B ) Hydrodynamic gene delivery approach. In brief, FASN fl/fl mice were either injected with the myr-AKT1 construct (AKT mice) ( A ) or co-injected with Myr-AKT1 and Cre recombinase plasmids (AKT/Cre mice) ( B ). Five mice per group were injected and sacrificed 32 weeks post-injection (w.p.i.). ( C ) Immunohistochemical analysis shows that hepatocellular tumor lesions (T) developed in AKT mice display robust immunoreactivity for FASN, HA-AKT, and SKP2 proteins. Note that in the tumor cells, the immunoreactivity for SKP2 is localized in the cytoplasmic and nuclear compartments, as appreciable at the 200× magnification. In contrast, the surrounding non-tumorous liver tissues (ST) show weak/absent staining for the same proteins. Abbreviation: H&E, hematoxylin and eosin staining. Original magnifications: 100× and 200×, as indicated. Scale bar: 100 µm in 100× magnification pictures, 50 µm in the 200× magnification picture. ( D ) Representative Western blot analysis showing the levels of FASN, SKP2, and p27KIP1 in livers from FASN fl/fl mice injected with the empty vector only (Control), Myr-AKT1 (AKT mice), and myr-AKT1/Cre (AKT/Cre mice). Note that AKT mice display upregulation of SKP2 and marked downregulation of p27 KIP1 . Suppression of FASN in AKT/Cre mice, which triggers the inhibition of hepatocarcinogenesis, is accompanied by downregulation of SKP2 and an increase of p27 KIP1 protein levels. β-Actin was used as a loading control. ( E ) Quantitative real-time RT-PCR showing the mRNA levels of Fasn , Skp2 , and Cdkn1b in livers from FASN fl/fl mice injected with the empty vector only (vector), Myr-AKT1 (AKT mice) and myr-AKT1/Cre (AKT/Cre mice). N target = 2 −ΔCt , wherein the ΔCt value of each sample was calculated by subtracting the average Ct value of the target gene from the average Ct value of the β- actin gene. Five mice per group were analyzed. Tukey–Kramer’s test: p < 0.0001; a , versus control livers (vector); b , versus AKT livers.

Article Snippet: Gene Expression Assays for human FASN (Hs01005622_m1), SKP2 (Hs01021864_m1), CDKN1B (Hs00153277_m1), and β-actin (4333762T), and mouse Fasn (Mm00662319_m1), Skp2 (Mm00449925_m1), Cdkn1b (Mm00438168_m1) and β-actin (mm00607939_S1) were from Applied Biosystems (Foster City, CA, USA).

Techniques: Injection, Construct, Immunohistochemical staining, Staining, Western Blot, Plasmid Preparation, Control, Inhibition, Quantitative RT-PCR

SKP2 inactivation or non-degradable p27 KIP1 suppresses AKT-dependent hepatocarcinogenesis in mice. In the upper panels, the hydrodynamic gene delivery approach is depicted. In brief, C57BL/6J mice were either co-injected with the HA-tagged myr-AKT1 and empty vector (AKT mice), with Myr-AKT1 and SKP2 dominant negative (AKT/SKP2dn mice), or with Myr-AKT1 and a non-degradable form of V5-tagged p27 KIP1 (p27 KIP1-T187A ; AKT/p27 KIP1 mice). Five mice per group were injected and sacrificed 32 weeks post-injection (w.p.i.). At this time point, as revealed by hematoxylin and eosin staining (H&E), the livers of AKT mice are occupied by several tumor nodules (T). In contrast, the livers of AKT/SKP2dn and AKT/p27 KIP1 mice appear completely normal (better appreciable in the pictures taken at higher magnification). Original magnifications: 40× and 100×. Scale bar: 500 µm in 40× magnification pictures, 200 µm in 100× magnification pictures.

Journal: Medicina

Article Title: Fatty Acid Synthase Promotes Hepatocellular Carcinoma Growth via S-Phase Kinase-Associated Protein 2/p27 KIP1 Regulation

doi: 10.3390/medicina60071160

Figure Lengend Snippet: SKP2 inactivation or non-degradable p27 KIP1 suppresses AKT-dependent hepatocarcinogenesis in mice. In the upper panels, the hydrodynamic gene delivery approach is depicted. In brief, C57BL/6J mice were either co-injected with the HA-tagged myr-AKT1 and empty vector (AKT mice), with Myr-AKT1 and SKP2 dominant negative (AKT/SKP2dn mice), or with Myr-AKT1 and a non-degradable form of V5-tagged p27 KIP1 (p27 KIP1-T187A ; AKT/p27 KIP1 mice). Five mice per group were injected and sacrificed 32 weeks post-injection (w.p.i.). At this time point, as revealed by hematoxylin and eosin staining (H&E), the livers of AKT mice are occupied by several tumor nodules (T). In contrast, the livers of AKT/SKP2dn and AKT/p27 KIP1 mice appear completely normal (better appreciable in the pictures taken at higher magnification). Original magnifications: 40× and 100×. Scale bar: 500 µm in 40× magnification pictures, 200 µm in 100× magnification pictures.

Article Snippet: Gene Expression Assays for human FASN (Hs01005622_m1), SKP2 (Hs01021864_m1), CDKN1B (Hs00153277_m1), and β-actin (4333762T), and mouse Fasn (Mm00662319_m1), Skp2 (Mm00449925_m1), Cdkn1b (Mm00438168_m1) and β-actin (mm00607939_S1) were from Applied Biosystems (Foster City, CA, USA).

Techniques: Injection, Plasmid Preparation, Dominant Negative Mutation, Staining

Inactivation of SKP2 or non-degradable p27 KIP1 is detrimental to the growth of HCC cells in vitro. ( A ) Transfection of SKP2dn triggers the upregulation of p27 KIP1 levels in SNU449 cells, as detected by Western blot analysis. As expected, transient transfection of SKP2dn resulted in the expression of a truncated form of SKP2 (transfected) with a lower molecular weight than the endogenous protein. β-Actin was used as a loading control. Transfection of SKP2dn reduces proliferation ( B ) and increases apoptosis ( C ) in the same cells. ( D ) Transfection of p27 KIP1−187A results in the appearance of a second band (transfected) with a higher molecular weight than the endogenous p27 KIP1 protein in the SNU449 cell line. β-Actin was used as a loading control. Similar to that described for SKP2dn, transfection of p27 KIP1−187A decreases proliferation ( E ) and augments apoptosis ( F ) in the same cell line. Student’s t -test: p < 0.0001 *** vs. empty vector (control). Experiments were conducted three times in triplicate.

Journal: Medicina

Article Title: Fatty Acid Synthase Promotes Hepatocellular Carcinoma Growth via S-Phase Kinase-Associated Protein 2/p27 KIP1 Regulation

doi: 10.3390/medicina60071160

Figure Lengend Snippet: Inactivation of SKP2 or non-degradable p27 KIP1 is detrimental to the growth of HCC cells in vitro. ( A ) Transfection of SKP2dn triggers the upregulation of p27 KIP1 levels in SNU449 cells, as detected by Western blot analysis. As expected, transient transfection of SKP2dn resulted in the expression of a truncated form of SKP2 (transfected) with a lower molecular weight than the endogenous protein. β-Actin was used as a loading control. Transfection of SKP2dn reduces proliferation ( B ) and increases apoptosis ( C ) in the same cells. ( D ) Transfection of p27 KIP1−187A results in the appearance of a second band (transfected) with a higher molecular weight than the endogenous p27 KIP1 protein in the SNU449 cell line. β-Actin was used as a loading control. Similar to that described for SKP2dn, transfection of p27 KIP1−187A decreases proliferation ( E ) and augments apoptosis ( F ) in the same cell line. Student’s t -test: p < 0.0001 *** vs. empty vector (control). Experiments were conducted three times in triplicate.

Article Snippet: Gene Expression Assays for human FASN (Hs01005622_m1), SKP2 (Hs01021864_m1), CDKN1B (Hs00153277_m1), and β-actin (4333762T), and mouse Fasn (Mm00662319_m1), Skp2 (Mm00449925_m1), Cdkn1b (Mm00438168_m1) and β-actin (mm00607939_S1) were from Applied Biosystems (Foster City, CA, USA).

Techniques: In Vitro, Transfection, Western Blot, Expressing, Molecular Weight, Control, Plasmid Preparation

Disruption of Gadd45a abolishes p38 activation after H-ras overexpression. (A) wt and Gadd45a−/− MEF were infected with H-ras-expressing retrovirus, and activities of ERK, JNK, and p38 were analyzed, with MBP, GST-Jun, and GST-ATF2 as substrates, respectively. puro, puromycin. (B) At the same time that the protein extracts were obtained, the levels of p16/Ink4a, p53, and p21/Waf1 were determined. (C) MEF were infected with either puromycin- or H-ras-expressing retroviruses, and 5 days after selection with puromycin, mRNA was purified and the levels of p53-inducible genes (those encoding p21/Waf1, XPC, and ATF2) were analyzed by using a quantitative filter hybridization procedure (29). The relative induction ratio was obtained after dividing the relative level of mRNA after infection with H-ras retrovirus by the level of mRNA after infection with puromycin vector alone. (D) The levels of Gadd45a and p19/ARF mRNA in wt and Gadd45a−/− MEF on day 5 after retroviral infection were measured by Northern blotting. GAPD was included as a loading control.

Journal:

Article Title: Loss of Oncogenic H-ras-Induced Cell Cycle Arrest and p38 Mitogen-Activated Protein Kinase Activation by Disruption of Gadd45a

doi: 10.1128/MCB.23.11.3859-3871.2003

Figure Lengend Snippet: Disruption of Gadd45a abolishes p38 activation after H-ras overexpression. (A) wt and Gadd45a−/− MEF were infected with H-ras-expressing retrovirus, and activities of ERK, JNK, and p38 were analyzed, with MBP, GST-Jun, and GST-ATF2 as substrates, respectively. puro, puromycin. (B) At the same time that the protein extracts were obtained, the levels of p16/Ink4a, p53, and p21/Waf1 were determined. (C) MEF were infected with either puromycin- or H-ras-expressing retroviruses, and 5 days after selection with puromycin, mRNA was purified and the levels of p53-inducible genes (those encoding p21/Waf1, XPC, and ATF2) were analyzed by using a quantitative filter hybridization procedure (29). The relative induction ratio was obtained after dividing the relative level of mRNA after infection with H-ras retrovirus by the level of mRNA after infection with puromycin vector alone. (D) The levels of Gadd45a and p19/ARF mRNA in wt and Gadd45a−/− MEF on day 5 after retroviral infection were measured by Northern blotting. GAPD was included as a loading control.

Article Snippet: Analysis of protein levels was carried out by using polyclonal antibodies (Abs) against p16/ink4a (M-156; Santa Cruz) and p53 (AB7; Oncogene), monoclonal Abs against p21/Waf1 (AB4; Oncogene) and actin (AB1; Oncogene), anti-Flag monoclonal Ab M2 (Sigma) or anti-Flag monoclonal Ab M2 conjugated with horseradish peroxidase (Sigma), anti-HA polyclonal Ab (Covance Research Products), anti-Myc-tag monoclonal Ab 9E10 (Santa Cruz), anti-Gadd45a polyclonal Ab H-165 (Santa Cruz), anti-p38 polyclonal Ab C-20 (Santa Cruz), anti-JNK polyclonal Ab C-17 (Santa Cruz), and anti-ERK2 polyclonal Ab C-14 (Santa Cruz).

Techniques: Activation Assay, Over Expression, Infection, Expressing, Selection, Purification, Hybridization, Plasmid Preparation, Northern Blot

Gadd45a and p38 are required for p53 activation after H-ras overexpression. (A) wt and Gadd45a−/− MEF were incubated in the presence of a MEK1 (50 μM PD98059) or p38 (10 μM SB202190) inhibitor, and protein extracts were obtained on day 5 after selection (see Materials and Methods). The levels of p16/Ink4a, p21/Waf1, and p53 proteins were analyzed. DMSO, dimethyl sulfoxide; puro, puromycin. (B) wt and Gadd45a−/− MEF were cotransfected with p53RE-CAT reporter plasmid and expression vectors containing either puromycin or H-ras. Some cells were additionally transfected with a dominant-negative p38α vector (p38DN). Four days later, cells were treated with either a MEK1 (PD90859) or p38 (SB202190) inhibitor, and CAT assays were carried out 12 h later. (C) wt and Gadd45a−/− MEF were cotransfected with p53RE-CAT reporter plasmid and expression vectors containing either puromycin or MKK6(E). Four days later, CAT activity was analyzed, and representative results are shown. Relative induction, as measured by increased CAT activity, was consistently twofold or greater in wt MEF compared to that in Gadd45a−/− MEF.

Journal:

Article Title: Loss of Oncogenic H-ras-Induced Cell Cycle Arrest and p38 Mitogen-Activated Protein Kinase Activation by Disruption of Gadd45a

doi: 10.1128/MCB.23.11.3859-3871.2003

Figure Lengend Snippet: Gadd45a and p38 are required for p53 activation after H-ras overexpression. (A) wt and Gadd45a−/− MEF were incubated in the presence of a MEK1 (50 μM PD98059) or p38 (10 μM SB202190) inhibitor, and protein extracts were obtained on day 5 after selection (see Materials and Methods). The levels of p16/Ink4a, p21/Waf1, and p53 proteins were analyzed. DMSO, dimethyl sulfoxide; puro, puromycin. (B) wt and Gadd45a−/− MEF were cotransfected with p53RE-CAT reporter plasmid and expression vectors containing either puromycin or H-ras. Some cells were additionally transfected with a dominant-negative p38α vector (p38DN). Four days later, cells were treated with either a MEK1 (PD90859) or p38 (SB202190) inhibitor, and CAT assays were carried out 12 h later. (C) wt and Gadd45a−/− MEF were cotransfected with p53RE-CAT reporter plasmid and expression vectors containing either puromycin or MKK6(E). Four days later, CAT activity was analyzed, and representative results are shown. Relative induction, as measured by increased CAT activity, was consistently twofold or greater in wt MEF compared to that in Gadd45a−/− MEF.

Article Snippet: Analysis of protein levels was carried out by using polyclonal antibodies (Abs) against p16/ink4a (M-156; Santa Cruz) and p53 (AB7; Oncogene), monoclonal Abs against p21/Waf1 (AB4; Oncogene) and actin (AB1; Oncogene), anti-Flag monoclonal Ab M2 (Sigma) or anti-Flag monoclonal Ab M2 conjugated with horseradish peroxidase (Sigma), anti-HA polyclonal Ab (Covance Research Products), anti-Myc-tag monoclonal Ab 9E10 (Santa Cruz), anti-Gadd45a polyclonal Ab H-165 (Santa Cruz), anti-p38 polyclonal Ab C-20 (Santa Cruz), anti-JNK polyclonal Ab C-17 (Santa Cruz), and anti-ERK2 polyclonal Ab C-14 (Santa Cruz).

Techniques: Activation Assay, Over Expression, Incubation, Selection, Plasmid Preparation, Expressing, Transfection, Dominant Negative Mutation, Activity Assay

Cells were treated with doses of 10 ng/ml FGF2, 1 μM PD-173074, and 10 μM U0126. (A) Western blot for phosphorylated and total Erk. Differentiation markers after 72-hour TβRIII knockdown and rescue with nontargeted shRNA or shRNA against TβRIII, with or without 1 ng/ml FGF2 treatment (gray bars). Densitometry for pErk normalized to total Erk is shown as percent control. 5Y cells were transduced for 96 hours. Quantification of densitometry from 4 independent experiments is shown (normalized mean ± SEM). P < 0.001 for main effect receptor (2-way ANOVA); P < 0.0001 for main effect FGF2 (2-way ANOVA); interaction P < 0.05. (B) Western blots following 96 hours of TβRIII transduction and treatment. Densitometry for NF160 normalized to β-actin is shown as percent control. (C) Western blots following 96 hours of transduction with TβRIII or GFP control and dominant-negative FGFR1 (dnFGFR1) or IRES-GFP vector control. GFP fluorescence was used to verify construct expression. Densitometry for NF160 normalized to β-actin is shown as percent control.

Journal: The Journal of Clinical Investigation

Article Title: Type III TGF-? receptor promotes FGF2-mediated neuronal differentiation in neuroblastoma

doi: 10.1172/JCI69657

Figure Lengend Snippet: Cells were treated with doses of 10 ng/ml FGF2, 1 μM PD-173074, and 10 μM U0126. (A) Western blot for phosphorylated and total Erk. Differentiation markers after 72-hour TβRIII knockdown and rescue with nontargeted shRNA or shRNA against TβRIII, with or without 1 ng/ml FGF2 treatment (gray bars). Densitometry for pErk normalized to total Erk is shown as percent control. 5Y cells were transduced for 96 hours. Quantification of densitometry from 4 independent experiments is shown (normalized mean ± SEM). P < 0.001 for main effect receptor (2-way ANOVA); P < 0.0001 for main effect FGF2 (2-way ANOVA); interaction P < 0.05. (B) Western blots following 96 hours of TβRIII transduction and treatment. Densitometry for NF160 normalized to β-actin is shown as percent control. (C) Western blots following 96 hours of transduction with TβRIII or GFP control and dominant-negative FGFR1 (dnFGFR1) or IRES-GFP vector control. GFP fluorescence was used to verify construct expression. Densitometry for NF160 normalized to β-actin is shown as percent control.

Article Snippet: Human basic fibroblast growth factor (no. 8910) and the MEK 1/2 inhibitor U0126 (no. 9903) were purchased from Cell Signaling.

Techniques: Western Blot, Knockdown, shRNA, Control, Transduction, Dominant Negative Mutation, Plasmid Preparation, Fluorescence, Construct, Expressing

Cells were treated with doses of 10 ng/ml FGF2, 1 μM PD-173074, and 10 μM U0126. (A) Western blot for Id1 in stable SHEP cells serum-starved 24 hours prior to FGF2 treatment. Densitometry analysis for Id1 normalized to β-actin is shown as percent control. (B) Western blot for Id1 in SHEP cells transduced and treated with FGF2 for 72 hours. Densitometry for Id1 normalized to β-actin is shown as percent control. (C) Western blot for Id1 in 5Y cells transduced for 96 hours. Densitometry for Id1 normalized to β-actin is shown as percent control. (D) 5Y cells were transduced for 96 hours with TβRIII or GFP control and Id1 siRNA (siId1) or nontargeted control siRNA. Densitometry for NF160 normalized to β-actin is shown as percent control. (E) Microarray data set expression of ID1 in tumors with low (bottom 10%) and high (top 10%) TGFBR3 expression (median [horizontal bars] and interquartile range [boxes]). ****P < 0.0001 (Mann-Whitney). Linear regression analysis of ID1 expression, which was dependent on TGFBR3 expression, in the microarray data set.

Journal: The Journal of Clinical Investigation

Article Title: Type III TGF-? receptor promotes FGF2-mediated neuronal differentiation in neuroblastoma

doi: 10.1172/JCI69657

Figure Lengend Snippet: Cells were treated with doses of 10 ng/ml FGF2, 1 μM PD-173074, and 10 μM U0126. (A) Western blot for Id1 in stable SHEP cells serum-starved 24 hours prior to FGF2 treatment. Densitometry analysis for Id1 normalized to β-actin is shown as percent control. (B) Western blot for Id1 in SHEP cells transduced and treated with FGF2 for 72 hours. Densitometry for Id1 normalized to β-actin is shown as percent control. (C) Western blot for Id1 in 5Y cells transduced for 96 hours. Densitometry for Id1 normalized to β-actin is shown as percent control. (D) 5Y cells were transduced for 96 hours with TβRIII or GFP control and Id1 siRNA (siId1) or nontargeted control siRNA. Densitometry for NF160 normalized to β-actin is shown as percent control. (E) Microarray data set expression of ID1 in tumors with low (bottom 10%) and high (top 10%) TGFBR3 expression (median [horizontal bars] and interquartile range [boxes]). ****P < 0.0001 (Mann-Whitney). Linear regression analysis of ID1 expression, which was dependent on TGFBR3 expression, in the microarray data set.

Article Snippet: Human basic fibroblast growth factor (no. 8910) and the MEK 1/2 inhibitor U0126 (no. 9903) were purchased from Cell Signaling.

Techniques: Western Blot, Control, Microarray, Expressing, MANN-WHITNEY

( A ) Scatter plot showing cardiac hypertrophy, as measured by Heart weight/Tibia Length (HW/TL) ratio of 8 weeks old 129/Sv mice treated with either vehicle or isoproterenol (ISO) at the dose of 10 mg/kg/day. ISO was continuously infused for 7 days using osmotic mini-pumps. n = 9–10 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. ( B ) Scatter plot representing left ventricular posterior wall thickness of 8 weeks old 129/Sv mice treated with either vehicle or ISO at the dose of 10 mg/kg/day. ISO was continuously infused for 7 days using osmotic mini-pumps. n = 6 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. ( C ) Scatter plot indicating the contractile functions of heart as represented by ejection fraction of 8 weeks old 129/Sv mice treated with either vehicle or ISO at the dose of 10 mg/kg/day. ISO was continuously infused for 7 days using osmotic mini-pumps. n = 6 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. ( D ) Histogram showing GSK3β activity assay in heart lysates of vehicle or ISO-treated 8 weeks old 129/Sv mice. Mice were treated with either vehicle or ISO at the dose of 10 mg/kg/day for 7 days using osmotic mini-pumps. GSK3β was immunoprecipitated from the heart lysates of vehicle or ISO infused mice using anti-GSK3β antibody, clone GSK-4B (Sigma). The immunoprecipitated GSK3β was incubated with the peptide substrate in the presence of γ− 32 P-ATP. The incorporation of 32 P into the GSK3β peptide substrate, which contains specific phosphorylation residues of GSK3β was measured. n = 10 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. ( E ) Eight weeks old 129/Sv mice were treated with either vehicle or ISO at the dose of 10 mg/kg/day for 7 days using osmotic mini-pumps. GSK3β was immunoprecipitated from the heart lysates of vehicle or ISO infused mice using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnolgy) and the affinity resin immobilized with protein A/G. Western blotting analysis was performed to detect the levels of GSK3β acetylation (Ac-Lys) by anti-acetyl-lysine antibody. IgG was used as negative control in this assay. Heart tissue lysates (WCL) were probed for indicated proteins by western blotting. ANP was used as a positive control to assess cardiac hypertrophy in ISO infused mice. n = 4 mice per group. # marked western blotting images denotes SIRT2 antibody (#12650; Cell Signaling), used in this assay detects single band. ( F ) Histogram showing relative acetylated GSK3β in vehicle and ISO-treated mice heart tissues, as measured from . Signal intensities of acetylated GSK3β and GSK3β were measured by densitometry analysis (ImageJ software). n = 4 mice per group. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( G ) GSK3β was immunoprecipitated from heart tissues of 8 weeks old 129/Sv mice using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnology), and the affinity resin with protein A/G immobilized. Western blotting was performed to detect GSK3β interaction with p300 using anti-p300 antibody. IgG was used as a negative control. Whole cell lysates (WCL) were probed for the presence of GSK3β and p300 by western blotting. ( H ) Co-localization of GSK3β with p300 was assessed in 293 T cells by confocal microscopy. The antibodies used are anti-GSK3β (sc-9166, Santacruz), and p300 (05–257, Millipore). DAPI was used to stain the nucleus. Expanded images (right small boxes) show yellow color in the merge image, indicating the co-localization of GSK3β (Green) and p300 (Red) in the nucleus. ( I ) In vitro binding assay to test the direct interaction between GSK3β and p300. Recombinant p300 (Millipore # 2273152) was incubated with recombinant GST or GST-GSK3β, purified from E. coli BL21 (DE3) by affinity chromatography using Glutathione Sepharose 4B. ( J ) Western blotting analysis showing the acetylation and activity of GSK3β in rat neonatal cardiomyocytes infected with adenovirus expressing either luciferase shRNA (control) or p300 shRNA (p300-KD) for 72 hr. Depletion of p300 was confirmed by western blotting. GSK3β was immunoprecipitated from control and p300-KD cells using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnology) and the affinity resin immobilized with protein A/G. Western blotting was performed to detect acetylation of GSK3β using the anti Ac-Lysine antibody. GSK3β activity was measured by assessing the phosphorylation of glycogen synthase (p–GS). Site-specific antibodies were used to detect the phosphorylation of GSK3β at indicated residues in cardiomyocyte lysates (WCL). ( K ) Histogram showing the quantification of relative acetylated GSK3β in control and p300 depleted (p300-KD) rat neonatal cardiomyocytes, as measured from . Rat neonatal cardiomyocytes were infected with adenovirus expressing either luciferase shRNA (control) or p300 shRNA (p300-KD) for 72 hr. Signal intensities of acetylated GSK3β and GSK3β were quantified by densitometry analysis (ImageJ software). n = 3 independent experiments. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( L ) Histogram depicting the activity of GSK3β in control and p300 depleted (p300-KD) rat neonatal cardiomyocytes, as measured by the ratio of phosphorylation of glycogen synthase vs total glycogen synthase from . Rat neonatal cardiomyocytes were infected with adenovirus expressing either luciferase shRNA (control) or p300 shRNA (p300-KD) for 72 hr. Signal intensities of phospho-glycogen synthase and glycogen synthase were measured by densitometry analysis (ImageJ software). n = 3 independent experiments. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( M ) Western blotting analysis showing the acetylation of GSK3β in rat neonatal cardiomyocytes infected with either control (Ad-null) or p300 overexpressing adenovirus (Ad-p300) for 24 hr. Overexpression of p300 was confirmed by western blotting. GSK3β was immunoprecipitated using anti-GSK3β antibody (sc-9166, Santacruz) and the affinity resin with protein A/G immobilized. Site-specific antibodies were used to detect the phosphorylation of GSK3β at indicated residues in cell lysates (WCL). ( N ) Western blotting analysis showing the activity of GSK3β in rat neonatal cardiomyocytes infected with control (Ad-null) or p300 expressing adenovirus (Ad-p300) for 24 hr. Overexpression of p300 was confirmed by western blotting and the activity of GSK3β was probed by assessing the levels of p-GS and GS by western blotting. ( O ) Histogram showing the activity of GSK3β in control (Ad-Null) or p300 overexpressing (Ad-p300) rat neonatal cardiomyocytes, as measured by the ratio of phosphorylation of glycogen synthase vs total glycogen synthase from . Signal intensities of phospho-glycogen synthase and glycogen synthase were assessed by densitometry analysis (ImageJ software). n = 3 independent experiments. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( P ) In vitro kinase assay showing the activity of acetylated and non-acetylated GSK3β. Human GSK3β with HA tag was overexpressed in HeLa cells by transfection of the plasmid pcDNA3-HA-GSK3β. HA-GSK3β was immunoprecipitated using HA-coupled agarose beads (Sigma-Aldrich) and the HA-GSK3β was acetylated by recombinant p300 (Millipore), in the presence or absence of Acetyl-CoA (Ac-CoA) in HAT buffer. The enzymatic activity of GSK3β was measured against glycogen synthase (GS)-peptide. n = 6 independent experiments. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values.

Journal: eLife

Article Title: SIRT2 deacetylase regulates the activity of GSK3 isoforms independent of inhibitory phosphorylation

doi: 10.7554/eLife.32952

Figure Lengend Snippet: ( A ) Scatter plot showing cardiac hypertrophy, as measured by Heart weight/Tibia Length (HW/TL) ratio of 8 weeks old 129/Sv mice treated with either vehicle or isoproterenol (ISO) at the dose of 10 mg/kg/day. ISO was continuously infused for 7 days using osmotic mini-pumps. n = 9–10 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. ( B ) Scatter plot representing left ventricular posterior wall thickness of 8 weeks old 129/Sv mice treated with either vehicle or ISO at the dose of 10 mg/kg/day. ISO was continuously infused for 7 days using osmotic mini-pumps. n = 6 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. ( C ) Scatter plot indicating the contractile functions of heart as represented by ejection fraction of 8 weeks old 129/Sv mice treated with either vehicle or ISO at the dose of 10 mg/kg/day. ISO was continuously infused for 7 days using osmotic mini-pumps. n = 6 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. ( D ) Histogram showing GSK3β activity assay in heart lysates of vehicle or ISO-treated 8 weeks old 129/Sv mice. Mice were treated with either vehicle or ISO at the dose of 10 mg/kg/day for 7 days using osmotic mini-pumps. GSK3β was immunoprecipitated from the heart lysates of vehicle or ISO infused mice using anti-GSK3β antibody, clone GSK-4B (Sigma). The immunoprecipitated GSK3β was incubated with the peptide substrate in the presence of γ− 32 P-ATP. The incorporation of 32 P into the GSK3β peptide substrate, which contains specific phosphorylation residues of GSK3β was measured. n = 10 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. ( E ) Eight weeks old 129/Sv mice were treated with either vehicle or ISO at the dose of 10 mg/kg/day for 7 days using osmotic mini-pumps. GSK3β was immunoprecipitated from the heart lysates of vehicle or ISO infused mice using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnolgy) and the affinity resin immobilized with protein A/G. Western blotting analysis was performed to detect the levels of GSK3β acetylation (Ac-Lys) by anti-acetyl-lysine antibody. IgG was used as negative control in this assay. Heart tissue lysates (WCL) were probed for indicated proteins by western blotting. ANP was used as a positive control to assess cardiac hypertrophy in ISO infused mice. n = 4 mice per group. # marked western blotting images denotes SIRT2 antibody (#12650; Cell Signaling), used in this assay detects single band. ( F ) Histogram showing relative acetylated GSK3β in vehicle and ISO-treated mice heart tissues, as measured from . Signal intensities of acetylated GSK3β and GSK3β were measured by densitometry analysis (ImageJ software). n = 4 mice per group. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( G ) GSK3β was immunoprecipitated from heart tissues of 8 weeks old 129/Sv mice using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnology), and the affinity resin with protein A/G immobilized. Western blotting was performed to detect GSK3β interaction with p300 using anti-p300 antibody. IgG was used as a negative control. Whole cell lysates (WCL) were probed for the presence of GSK3β and p300 by western blotting. ( H ) Co-localization of GSK3β with p300 was assessed in 293 T cells by confocal microscopy. The antibodies used are anti-GSK3β (sc-9166, Santacruz), and p300 (05–257, Millipore). DAPI was used to stain the nucleus. Expanded images (right small boxes) show yellow color in the merge image, indicating the co-localization of GSK3β (Green) and p300 (Red) in the nucleus. ( I ) In vitro binding assay to test the direct interaction between GSK3β and p300. Recombinant p300 (Millipore # 2273152) was incubated with recombinant GST or GST-GSK3β, purified from E. coli BL21 (DE3) by affinity chromatography using Glutathione Sepharose 4B. ( J ) Western blotting analysis showing the acetylation and activity of GSK3β in rat neonatal cardiomyocytes infected with adenovirus expressing either luciferase shRNA (control) or p300 shRNA (p300-KD) for 72 hr. Depletion of p300 was confirmed by western blotting. GSK3β was immunoprecipitated from control and p300-KD cells using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnology) and the affinity resin immobilized with protein A/G. Western blotting was performed to detect acetylation of GSK3β using the anti Ac-Lysine antibody. GSK3β activity was measured by assessing the phosphorylation of glycogen synthase (p–GS). Site-specific antibodies were used to detect the phosphorylation of GSK3β at indicated residues in cardiomyocyte lysates (WCL). ( K ) Histogram showing the quantification of relative acetylated GSK3β in control and p300 depleted (p300-KD) rat neonatal cardiomyocytes, as measured from . Rat neonatal cardiomyocytes were infected with adenovirus expressing either luciferase shRNA (control) or p300 shRNA (p300-KD) for 72 hr. Signal intensities of acetylated GSK3β and GSK3β were quantified by densitometry analysis (ImageJ software). n = 3 independent experiments. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( L ) Histogram depicting the activity of GSK3β in control and p300 depleted (p300-KD) rat neonatal cardiomyocytes, as measured by the ratio of phosphorylation of glycogen synthase vs total glycogen synthase from . Rat neonatal cardiomyocytes were infected with adenovirus expressing either luciferase shRNA (control) or p300 shRNA (p300-KD) for 72 hr. Signal intensities of phospho-glycogen synthase and glycogen synthase were measured by densitometry analysis (ImageJ software). n = 3 independent experiments. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( M ) Western blotting analysis showing the acetylation of GSK3β in rat neonatal cardiomyocytes infected with either control (Ad-null) or p300 overexpressing adenovirus (Ad-p300) for 24 hr. Overexpression of p300 was confirmed by western blotting. GSK3β was immunoprecipitated using anti-GSK3β antibody (sc-9166, Santacruz) and the affinity resin with protein A/G immobilized. Site-specific antibodies were used to detect the phosphorylation of GSK3β at indicated residues in cell lysates (WCL). ( N ) Western blotting analysis showing the activity of GSK3β in rat neonatal cardiomyocytes infected with control (Ad-null) or p300 expressing adenovirus (Ad-p300) for 24 hr. Overexpression of p300 was confirmed by western blotting and the activity of GSK3β was probed by assessing the levels of p-GS and GS by western blotting. ( O ) Histogram showing the activity of GSK3β in control (Ad-Null) or p300 overexpressing (Ad-p300) rat neonatal cardiomyocytes, as measured by the ratio of phosphorylation of glycogen synthase vs total glycogen synthase from . Signal intensities of phospho-glycogen synthase and glycogen synthase were assessed by densitometry analysis (ImageJ software). n = 3 independent experiments. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( P ) In vitro kinase assay showing the activity of acetylated and non-acetylated GSK3β. Human GSK3β with HA tag was overexpressed in HeLa cells by transfection of the plasmid pcDNA3-HA-GSK3β. HA-GSK3β was immunoprecipitated using HA-coupled agarose beads (Sigma-Aldrich) and the HA-GSK3β was acetylated by recombinant p300 (Millipore), in the presence or absence of Acetyl-CoA (Ac-CoA) in HAT buffer. The enzymatic activity of GSK3β was measured against glycogen synthase (GS)-peptide. n = 6 independent experiments. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values.

Article Snippet: Transfected construct (human) , HA GSK3 beta K183Q pcDNA3 , Modified Addgene, plasmid 14755 , This paper , For, gcaggttctgcggctgaatatcgcgatggcaaatgccaaag; Rev, ctttggcatttgccatcgcgatattcagccgcagaacctgc;.

Techniques: Activity Assay, Immunoprecipitation, Incubation, Phospho-proteomics, Western Blot, Negative Control, Positive Control, Software, Confocal Microscopy, Staining, In Vitro, Binding Assay, Recombinant, Purification, Affinity Chromatography, Infection, Expressing, Luciferase, shRNA, Control, Over Expression, Kinase Assay, Transfection, Plasmid Preparation

( A ) Annotation of representative tandem mass spectra of trypsin-digested GSK3β, depicting K150 and K183 acetylation. ( B ) Representation of the acetylation sites on the crystal structure of GSK3β (PDB ID 4NM0): ( i ) surface (ii) cartoon representation. (iii) Magnified active site representing position of K183 and (iv) magnified active site representing position of acetylated K183 (acK183). ( C ) Nucleotide-binding site in GSK3β crystal structure (PDB ID 4NM0) representing ADP, nucleotide interacting residues and K183. ( D ) Overlay of the wild-type (blue) and acK183 mutant (orange) of GSK3β representing the surface of ADP nucleotide, at random snapshots in the MD trajectory. ( E ) Overlay of protein backbone Cα RMSD plots of the five 20 ns MD trajectories in wild type. ( F ) Overlay of ADP nucleotide RMSD plots of the five 20 ns MD trajectories in wild type. ( G ) Overlay of the distance between the NZ atom of K85 and α-phosphate of ADP as a function of time for two stable trajectories (dark blue/cyan – wild type, pink/red – acK183). ( H ) Overlay of protein backbone Cα RMSD plots of the five 20 ns MD trajectories in acK183 mutant. ( I ) Overlay of ADP nucleotide RMSD plots of the five 20 ns MD trajectories in acK183 mutant. ( J ) Overlay of the distance between the NZ atom of K85 and β-phosphate of ADP as a function of time for two stable trajectories (dark blue/cyan – wild type, pink/red – acK183). ( K ) Histogram showing binding of γ− 32 P-ATP to recombinant wild type and mutants of His-GSK3β. Plasmids encoding wild type and mutants of His-GSK3β were transformed into E. coli BL21 (DE3). His-GSK3β and its mutants were purified by Ni-NTA affinity chromatography. n = 4 independent experiments. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values. ( L ) Histogram showing activity of HA-tagged WT or mutants of GSK3β. HA-tagged human GSK3β or its mutants were overexpressed in HeLa cells by transfection of their respective plasmids. HA-GSK3β or its mutants were immunoprecipitated using HA-coupled agarose beads (Sigma-Aldrich). The enzymatic activity of GSK3β was measured against glycogen synthase (GS)-peptide as described in the Materials and methods section. GSK3β-DN - GSK3β-K85A; Dominant negative. GSK3β-CA- GSK3β S9A; catalytically active. n = 4 independent experiments. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values.

Journal: eLife

Article Title: SIRT2 deacetylase regulates the activity of GSK3 isoforms independent of inhibitory phosphorylation

doi: 10.7554/eLife.32952

Figure Lengend Snippet: ( A ) Annotation of representative tandem mass spectra of trypsin-digested GSK3β, depicting K150 and K183 acetylation. ( B ) Representation of the acetylation sites on the crystal structure of GSK3β (PDB ID 4NM0): ( i ) surface (ii) cartoon representation. (iii) Magnified active site representing position of K183 and (iv) magnified active site representing position of acetylated K183 (acK183). ( C ) Nucleotide-binding site in GSK3β crystal structure (PDB ID 4NM0) representing ADP, nucleotide interacting residues and K183. ( D ) Overlay of the wild-type (blue) and acK183 mutant (orange) of GSK3β representing the surface of ADP nucleotide, at random snapshots in the MD trajectory. ( E ) Overlay of protein backbone Cα RMSD plots of the five 20 ns MD trajectories in wild type. ( F ) Overlay of ADP nucleotide RMSD plots of the five 20 ns MD trajectories in wild type. ( G ) Overlay of the distance between the NZ atom of K85 and α-phosphate of ADP as a function of time for two stable trajectories (dark blue/cyan – wild type, pink/red – acK183). ( H ) Overlay of protein backbone Cα RMSD plots of the five 20 ns MD trajectories in acK183 mutant. ( I ) Overlay of ADP nucleotide RMSD plots of the five 20 ns MD trajectories in acK183 mutant. ( J ) Overlay of the distance between the NZ atom of K85 and β-phosphate of ADP as a function of time for two stable trajectories (dark blue/cyan – wild type, pink/red – acK183). ( K ) Histogram showing binding of γ− 32 P-ATP to recombinant wild type and mutants of His-GSK3β. Plasmids encoding wild type and mutants of His-GSK3β were transformed into E. coli BL21 (DE3). His-GSK3β and its mutants were purified by Ni-NTA affinity chromatography. n = 4 independent experiments. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values. ( L ) Histogram showing activity of HA-tagged WT or mutants of GSK3β. HA-tagged human GSK3β or its mutants were overexpressed in HeLa cells by transfection of their respective plasmids. HA-GSK3β or its mutants were immunoprecipitated using HA-coupled agarose beads (Sigma-Aldrich). The enzymatic activity of GSK3β was measured against glycogen synthase (GS)-peptide as described in the Materials and methods section. GSK3β-DN - GSK3β-K85A; Dominant negative. GSK3β-CA- GSK3β S9A; catalytically active. n = 4 independent experiments. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values.

Article Snippet: Transfected construct (human) , HA GSK3 beta K183Q pcDNA3 , Modified Addgene, plasmid 14755 , This paper , For, gcaggttctgcggctgaatatcgcgatggcaaatgccaaag; Rev, ctttggcatttgccatcgcgatattcagccgcagaacctgc;.

Techniques: Binding Assay, Mutagenesis, Recombinant, Transformation Assay, Purification, Affinity Chromatography, Activity Assay, Transfection, Immunoprecipitation, Dominant Negative Mutation

Homology alignment of GSK3β between different species.

Journal: eLife

Article Title: SIRT2 deacetylase regulates the activity of GSK3 isoforms independent of inhibitory phosphorylation

doi: 10.7554/eLife.32952

Figure Lengend Snippet: Homology alignment of GSK3β between different species.

Article Snippet: Transfected construct (human) , HA GSK3 beta K183Q pcDNA3 , Modified Addgene, plasmid 14755 , This paper , For, gcaggttctgcggctgaatatcgcgatggcaaatgccaaag; Rev, ctttggcatttgccatcgcgatattcagccgcagaacctgc;.

Techniques:

Stoichiometry for GSK3β-K150, -K183 acetylation.

Journal: eLife

Article Title: SIRT2 deacetylase regulates the activity of GSK3 isoforms independent of inhibitory phosphorylation

doi: 10.7554/eLife.32952

Figure Lengend Snippet: Stoichiometry for GSK3β-K150, -K183 acetylation.

Article Snippet: Transfected construct (human) , HA GSK3 beta K183Q pcDNA3 , Modified Addgene, plasmid 14755 , This paper , For, gcaggttctgcggctgaatatcgcgatggcaaatgccaaag; Rev, ctttggcatttgccatcgcgatattcagccgcagaacctgc;.

Techniques:

Cells were transiently overexpressed with either pcDNA-Flag or pcDNA-Flag-SIRT1-7 plasmid for 48 hr, and western blotting was performed to detect the indicated proteins. HeLa cell lysates (WCL) were probed with Flag-antibody for detecting the expression of Sirtuins. GSK3β was immunoprecipitated from these overexpressed lysates using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechology) and tested for its acetylation by western blotting using anti-Ac-Lys antibody.

Journal: eLife

Article Title: SIRT2 deacetylase regulates the activity of GSK3 isoforms independent of inhibitory phosphorylation

doi: 10.7554/eLife.32952

Figure Lengend Snippet: Cells were transiently overexpressed with either pcDNA-Flag or pcDNA-Flag-SIRT1-7 plasmid for 48 hr, and western blotting was performed to detect the indicated proteins. HeLa cell lysates (WCL) were probed with Flag-antibody for detecting the expression of Sirtuins. GSK3β was immunoprecipitated from these overexpressed lysates using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechology) and tested for its acetylation by western blotting using anti-Ac-Lys antibody.

Article Snippet: Transfected construct (human) , HA GSK3 beta K183Q pcDNA3 , Modified Addgene, plasmid 14755 , This paper , For, gcaggttctgcggctgaatatcgcgatggcaaatgccaaag; Rev, ctttggcatttgccatcgcgatattcagccgcagaacctgc;.

Techniques: Plasmid Preparation, Western Blot, Expressing, Immunoprecipitation

( A ) Western blot analysis of acetylated GSK3β in heart samples of 9 months old WT and SIRT2-KO littermates. GSK3β was immunoprecipitated from heart tissue lysates of WT and SIRT2-KO mice using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnolgy), and the affinity resin immobilized with protein A/G. Western blotting was performed to detect GSK3β acetylation by anti-Ac-Lysine antibody. IgG was used as a negative control. Whole cell lysates (WCL) were probed for the SIRT2 and GAPDH by western blotting. n = 4 mice per group. ( B ) Histogram showing relative acetylated GSK3β in 9 months old WT and SIRT2-KO mice heart tissues, as measured from . Signal intensities of acetylated GSK3β and GSK3β were measured by densitometry analysis (ImageJ software). n = 4 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. ( C ) GSK3β was immunoprecipitated from heart tissue lysates of 8 weeks old 129/Sv mice using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnolgy ), and the affinity resin immobilized with protein A/G. GSK3β interaction with SIRT2 was tested by western blotting using anti-SIRT2 antibody. IgG was used as negative control. Heart lysates was probed for indicated proteins by western blotting. ( D ) In vitro binding assay to test the interaction between GSK3β and SIRT2. Flag-SIRT2 was overexpressed in 293 cells by a plasmid encoding human Flag-SIRT2. Recombinant His or His-GSK3β was purified from E. coli BL21 (DE3) by Ni-NTA affinity chromatography and were incubated with 293 T cell lysates overexpressing human Flag-SIRT2. Interaction between GSK3β and SIRT2 was tested by western blotting. # marked western images denotes SIRT2 antibody used in this assay detects single band. ( E ) In vitro deacetylation assay showing SIRT2 as GSK3β deacetylase. Human HA-GSK3β was overexpressed in HeLa cells by transfection of the plasmid pcDNA3-HA-GSK3β. HA-GSK3β was immunoprecipitated using HA-coupled agarose beads (Sigma-Aldrich) and the HA-GSK3β was acetylated by recombinant p300 (Millipore), in the presence or absence of Acetyl-CoA (Ac-CoA) in HAT buffer. The acetylated HA-GSK3β was further incubated with either Flag-tagged SIRT2 or SIRT2-H187Y, which were immunoprecipitated from HEK 293 cell lysates overexpressing respective plasmids encoding Flag-tagged WT or SIRT2-H187Y using agarose beads conjugated to anti-Flag antibody (Sigma A2220). The deacetylation reaction was carried out in the presence or absence of NAD + in a HDAC buffer. GSK3β acetylation was analyzed by western blotting using anti-Ac-Lysine antibody. # marked western images denotes SIRT2 antibody used in this assay detects single band. ( F ) In vitro kinase assay depicting the activity of acetylated and deacetylated GSK3β. Human HA-GSK3β was overexpressed in HeLa cells by transfection of the plasmid pcDNA3-HA-GSK3β. Recombinant HA-GSK3β was immunoprecipitated using HA-coupled beads and was acetylated by recombinant p300 in the presence or absence of Acetyl-CoA (Ac-CoA) in HAT buffer. Acetylated GSK3β was further deacetylated by either Flag-tagged WT or SIRT2-H187Y (SIRT2-HY), a catalytic inactive mutant of SIRT2, which was immunoprecipitated from HEK 293 cells, overexpressed with plasmid encoding Flag-tagged WT or SIRT2-H187Y using agarose beads conjugated to anti-Flag antibody (Sigma A2220). The deacetylation reaction was carried out in the presence or absence of NAD + in a HDAC buffer and further enzymatic activity of GSK3β was measured against glycogen synthase (GS)-peptide, as described in the Materials and methods section. n = 5. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values. ( G ) Western blot analysis of acetylated GSK3β from control or SIRT2-depleted (SIRT2-KD) cardiomyocytes. Neonatal rat cardiomyocytes were transfected with either non-targeting (control) or siRNA targeting SIRT2 using Lipofectamine RNAiMAX reagent for 72 hr. SIRT2 depletion was confirmed by Western blotting. Total cellular acetylation was probed by anti-Ac-Lysine antibody to test the effect of SIRT2 depletion in cardiomyocytes. GSK3β was immunoprecipitated from these cell lysates using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnolgy), and the affinity resin immobilized with protein A/G. Western blotting was performed to detect acetylation of GSK3β by anti-Ac-Lysine antibody. Cell lysates (WCL) from control and SIRT2-KD cardiomyocytes were probed for indicated proteins by western blotting. ( H ) Western blotting analysis of hearts lysates from 9 months old WT and SIRT2-KO mice littermates for indicated proteins. n = 4 mice per group. ( I ) Histogram showing activity of GSK3β in WT and SIRT2-KO mice hearts at 9 months of age. GSK3β was immunoprecipitated from the heart lysates of WT and SIRT2-KO mice using anti-GSK3β antibody, clone GSK-4B (Sigma). The immunoprecipitated GSK3β was incubated with the peptide substrate in the presence of γ− 32 P-ATP. The incorporation of 32 P into the GSK3β Peptide Substrate, which contains specific phosphorylation residue of GSK3β was measured. n = 6 mice per group. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( J ) In vitro deacetylation assay to test whether SIRT2 deacetylates K183 residue of GSK3β. HA-tagged GSK3β or GSK3β-K183R was overexpressed in HeLa cells and was immunoprecipitated using HA-coupled beads. HA-tagged WT-GSK3β or GSK3β-K183R were incubated with Flag-SIRT2 immunoprecipitated from HEK 293 T cells using agarose beads conjugated to Anti-Flag antibody (Sigma A2220). The deacetylation reaction was carried out in the presence or absence of NAD + in a deacetylation buffer. Acetylation status of GSK3β was analyzed by western blotting. # marked western images denotes SIRT2 antibody used in this assay detects single band. ( K ) Histogram showing relative acetylation of HA-tagged GSK3β or GSK3β-K183R, which was incubated with Flag-SIRT2. The data is generated from . Signal intensities of acetylated-GSK3β and GSK3β were measured by densitometry analysis (ImageJ software). n = 4 independent experiments. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values. ( L ) Histogram showing binding of γ− 32 P-ATP to acetylated and deacetylated His-GSK3β. Recombinant His-GSK3β was purified from E. coli BL 21 (DE3) by Ni-NTA affinity chromatography. Purified His-GSK3β was acetylated by recombinant p300 in the presence of Ac-CoA in HAT buffer. Acetylated His-GSK3β was further deacetylated by Flag-SIRT2 immunoprecipitated from HEK 293 T cells. The binding of γ− 32 P-ATP to acetylated and deacetylated His-GSK3β was assessed by the protocol described in Materials and methods section. n = 4. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values. ( M ) Histogram showing activity of WT or mutants of GSK3β. HA-tagged WT or mutants of GSK3β was immunoprecipitated from HeLa cells transfected with respective plasmids using HA-coupled agarose beads. The enzymatic activity of GSK3β was measured against glycogen synthase (GS)-peptide, as described in the Materials and methods section. n = 4. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values.

Journal: eLife

Article Title: SIRT2 deacetylase regulates the activity of GSK3 isoforms independent of inhibitory phosphorylation

doi: 10.7554/eLife.32952

Figure Lengend Snippet: ( A ) Western blot analysis of acetylated GSK3β in heart samples of 9 months old WT and SIRT2-KO littermates. GSK3β was immunoprecipitated from heart tissue lysates of WT and SIRT2-KO mice using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnolgy), and the affinity resin immobilized with protein A/G. Western blotting was performed to detect GSK3β acetylation by anti-Ac-Lysine antibody. IgG was used as a negative control. Whole cell lysates (WCL) were probed for the SIRT2 and GAPDH by western blotting. n = 4 mice per group. ( B ) Histogram showing relative acetylated GSK3β in 9 months old WT and SIRT2-KO mice heart tissues, as measured from . Signal intensities of acetylated GSK3β and GSK3β were measured by densitometry analysis (ImageJ software). n = 4 mice per group. Data is presented as mean ± s.d, *p<0.05. Student’s t test was used to calculate the p values. ( C ) GSK3β was immunoprecipitated from heart tissue lysates of 8 weeks old 129/Sv mice using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnolgy ), and the affinity resin immobilized with protein A/G. GSK3β interaction with SIRT2 was tested by western blotting using anti-SIRT2 antibody. IgG was used as negative control. Heart lysates was probed for indicated proteins by western blotting. ( D ) In vitro binding assay to test the interaction between GSK3β and SIRT2. Flag-SIRT2 was overexpressed in 293 cells by a plasmid encoding human Flag-SIRT2. Recombinant His or His-GSK3β was purified from E. coli BL21 (DE3) by Ni-NTA affinity chromatography and were incubated with 293 T cell lysates overexpressing human Flag-SIRT2. Interaction between GSK3β and SIRT2 was tested by western blotting. # marked western images denotes SIRT2 antibody used in this assay detects single band. ( E ) In vitro deacetylation assay showing SIRT2 as GSK3β deacetylase. Human HA-GSK3β was overexpressed in HeLa cells by transfection of the plasmid pcDNA3-HA-GSK3β. HA-GSK3β was immunoprecipitated using HA-coupled agarose beads (Sigma-Aldrich) and the HA-GSK3β was acetylated by recombinant p300 (Millipore), in the presence or absence of Acetyl-CoA (Ac-CoA) in HAT buffer. The acetylated HA-GSK3β was further incubated with either Flag-tagged SIRT2 or SIRT2-H187Y, which were immunoprecipitated from HEK 293 cell lysates overexpressing respective plasmids encoding Flag-tagged WT or SIRT2-H187Y using agarose beads conjugated to anti-Flag antibody (Sigma A2220). The deacetylation reaction was carried out in the presence or absence of NAD + in a HDAC buffer. GSK3β acetylation was analyzed by western blotting using anti-Ac-Lysine antibody. # marked western images denotes SIRT2 antibody used in this assay detects single band. ( F ) In vitro kinase assay depicting the activity of acetylated and deacetylated GSK3β. Human HA-GSK3β was overexpressed in HeLa cells by transfection of the plasmid pcDNA3-HA-GSK3β. Recombinant HA-GSK3β was immunoprecipitated using HA-coupled beads and was acetylated by recombinant p300 in the presence or absence of Acetyl-CoA (Ac-CoA) in HAT buffer. Acetylated GSK3β was further deacetylated by either Flag-tagged WT or SIRT2-H187Y (SIRT2-HY), a catalytic inactive mutant of SIRT2, which was immunoprecipitated from HEK 293 cells, overexpressed with plasmid encoding Flag-tagged WT or SIRT2-H187Y using agarose beads conjugated to anti-Flag antibody (Sigma A2220). The deacetylation reaction was carried out in the presence or absence of NAD + in a HDAC buffer and further enzymatic activity of GSK3β was measured against glycogen synthase (GS)-peptide, as described in the Materials and methods section. n = 5. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values. ( G ) Western blot analysis of acetylated GSK3β from control or SIRT2-depleted (SIRT2-KD) cardiomyocytes. Neonatal rat cardiomyocytes were transfected with either non-targeting (control) or siRNA targeting SIRT2 using Lipofectamine RNAiMAX reagent for 72 hr. SIRT2 depletion was confirmed by Western blotting. Total cellular acetylation was probed by anti-Ac-Lysine antibody to test the effect of SIRT2 depletion in cardiomyocytes. GSK3β was immunoprecipitated from these cell lysates using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnolgy), and the affinity resin immobilized with protein A/G. Western blotting was performed to detect acetylation of GSK3β by anti-Ac-Lysine antibody. Cell lysates (WCL) from control and SIRT2-KD cardiomyocytes were probed for indicated proteins by western blotting. ( H ) Western blotting analysis of hearts lysates from 9 months old WT and SIRT2-KO mice littermates for indicated proteins. n = 4 mice per group. ( I ) Histogram showing activity of GSK3β in WT and SIRT2-KO mice hearts at 9 months of age. GSK3β was immunoprecipitated from the heart lysates of WT and SIRT2-KO mice using anti-GSK3β antibody, clone GSK-4B (Sigma). The immunoprecipitated GSK3β was incubated with the peptide substrate in the presence of γ− 32 P-ATP. The incorporation of 32 P into the GSK3β Peptide Substrate, which contains specific phosphorylation residue of GSK3β was measured. n = 6 mice per group. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( J ) In vitro deacetylation assay to test whether SIRT2 deacetylates K183 residue of GSK3β. HA-tagged GSK3β or GSK3β-K183R was overexpressed in HeLa cells and was immunoprecipitated using HA-coupled beads. HA-tagged WT-GSK3β or GSK3β-K183R were incubated with Flag-SIRT2 immunoprecipitated from HEK 293 T cells using agarose beads conjugated to Anti-Flag antibody (Sigma A2220). The deacetylation reaction was carried out in the presence or absence of NAD + in a deacetylation buffer. Acetylation status of GSK3β was analyzed by western blotting. # marked western images denotes SIRT2 antibody used in this assay detects single band. ( K ) Histogram showing relative acetylation of HA-tagged GSK3β or GSK3β-K183R, which was incubated with Flag-SIRT2. The data is generated from . Signal intensities of acetylated-GSK3β and GSK3β were measured by densitometry analysis (ImageJ software). n = 4 independent experiments. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values. ( L ) Histogram showing binding of γ− 32 P-ATP to acetylated and deacetylated His-GSK3β. Recombinant His-GSK3β was purified from E. coli BL 21 (DE3) by Ni-NTA affinity chromatography. Purified His-GSK3β was acetylated by recombinant p300 in the presence of Ac-CoA in HAT buffer. Acetylated His-GSK3β was further deacetylated by Flag-SIRT2 immunoprecipitated from HEK 293 T cells. The binding of γ− 32 P-ATP to acetylated and deacetylated His-GSK3β was assessed by the protocol described in Materials and methods section. n = 4. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values. ( M ) Histogram showing activity of WT or mutants of GSK3β. HA-tagged WT or mutants of GSK3β was immunoprecipitated from HeLa cells transfected with respective plasmids using HA-coupled agarose beads. The enzymatic activity of GSK3β was measured against glycogen synthase (GS)-peptide, as described in the Materials and methods section. n = 4. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values.

Article Snippet: Transfected construct (human) , HA GSK3 beta K183Q pcDNA3 , Modified Addgene, plasmid 14755 , This paper , For, gcaggttctgcggctgaatatcgcgatggcaaatgccaaag; Rev, ctttggcatttgccatcgcgatattcagccgcagaacctgc;.

Techniques: Western Blot, Immunoprecipitation, Negative Control, Software, In Vitro, Binding Assay, Plasmid Preparation, Recombinant, Purification, Affinity Chromatography, Incubation, Histone Deacetylase Assay, Transfection, Kinase Assay, Activity Assay, Mutagenesis, Control, Phospho-proteomics, Residue, Generated

Acetylation of tubulin at K40, which is a specific deacetylation target of SIRT2 was probed to test the efficacy of SIRT2 inhibition. GSK3β was immunoprecipitated from these cell lysates using anti-GSK3β antibody, and the affinity resin immobilized with protein A/G. GSK3β acetylation was detected by Western blotting.

Journal: eLife

Article Title: SIRT2 deacetylase regulates the activity of GSK3 isoforms independent of inhibitory phosphorylation

doi: 10.7554/eLife.32952

Figure Lengend Snippet: Acetylation of tubulin at K40, which is a specific deacetylation target of SIRT2 was probed to test the efficacy of SIRT2 inhibition. GSK3β was immunoprecipitated from these cell lysates using anti-GSK3β antibody, and the affinity resin immobilized with protein A/G. GSK3β acetylation was detected by Western blotting.

Article Snippet: Transfected construct (human) , HA GSK3 beta K183Q pcDNA3 , Modified Addgene, plasmid 14755 , This paper , For, gcaggttctgcggctgaatatcgcgatggcaaatgccaaag; Rev, ctttggcatttgccatcgcgatattcagccgcagaacctgc;.

Techniques: Inhibition, Immunoprecipitation, Western Blot

Immunostaining was performed using HA antibody to localize WT and mutants of GSK3β (Red).

Journal: eLife

Article Title: SIRT2 deacetylase regulates the activity of GSK3 isoforms independent of inhibitory phosphorylation

doi: 10.7554/eLife.32952

Figure Lengend Snippet: Immunostaining was performed using HA antibody to localize WT and mutants of GSK3β (Red).

Article Snippet: Transfected construct (human) , HA GSK3 beta K183Q pcDNA3 , Modified Addgene, plasmid 14755 , This paper , For, gcaggttctgcggctgaatatcgcgatggcaaatgccaaag; Rev, ctttggcatttgccatcgcgatattcagccgcagaacctgc;.

Techniques: Immunostaining

( A ) Western blot analysis showing acetylation status of both isoforms of GSK3 in control or SIRT2 depleted (SIRT2-KD) cardiomyocytes. Neonatal rat cardiomyocytes were transfected with either non-targeting or siRNA pool targeting SIRT2 using Lipofectamine RNAiMAX reagent for 72 hr. SIRT2 depletion was confirmed by western blotting. GSK3 was immunoprecipitated from cell lysates using anti-GSK3 antibody and the affinity resin immobilized with protein A/G. Western blotting was performed to detect GSK3α/β acetylation by anti-Ac-Lysine antibody. Cell lysates was probed for SIRT2 and actin antibodies by western blotting. ( B ) Histogram showing relative acetylated-GSK3α and GSK3β in control and SIRT2-depleted (SIRT2-KD) cardiomyocytes, as measured from . Signal intensities of acetylated-GSK3α and acetylated-GSK3β were measured by densitometry analysis (ImageJ software). n = 3. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( C ) Histogram showing enzymatic activity of acetylated and deacetylated GSK3α. Recombinant HA- GSK3α was immunoprecipitated from HeLa cells overexpressing pcDNA-HA-GSK3α using HA-coupled agarose beads. Immunoprecipitated HA-GSK3α was acetylated by p300 in the presence of Acetyl-CoA (Ac-CoA) in HAT buffer. Acetylated GSK3α was further deacetylated by Flag-SIRT2 immunoprecipitated from HEK 293 T cells overexpressing plasmid encoding Flag-tagged SIRT2-WT using agarose beads conjugated to anti-Flag antibody (Sigma A2220). The enzymatic activity of GSK3α was measured against glycogen synthase (GS)-peptide. n = 5. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values. ( D ) Annotation of representative tandem mass spectra of trypsin-digested GSK3α, depicting K99, K246 acetylation. ( E ) Protein sequence alignment of the modeled region of GSK3α and the structure of GSK3β. ( F ) Cartoon, surface representation of the homology model of GSK3α (highlighted is the adenine nucleotide-binding pocket and position of K246 residue).

Journal: eLife

Article Title: SIRT2 deacetylase regulates the activity of GSK3 isoforms independent of inhibitory phosphorylation

doi: 10.7554/eLife.32952

Figure Lengend Snippet: ( A ) Western blot analysis showing acetylation status of both isoforms of GSK3 in control or SIRT2 depleted (SIRT2-KD) cardiomyocytes. Neonatal rat cardiomyocytes were transfected with either non-targeting or siRNA pool targeting SIRT2 using Lipofectamine RNAiMAX reagent for 72 hr. SIRT2 depletion was confirmed by western blotting. GSK3 was immunoprecipitated from cell lysates using anti-GSK3 antibody and the affinity resin immobilized with protein A/G. Western blotting was performed to detect GSK3α/β acetylation by anti-Ac-Lysine antibody. Cell lysates was probed for SIRT2 and actin antibodies by western blotting. ( B ) Histogram showing relative acetylated-GSK3α and GSK3β in control and SIRT2-depleted (SIRT2-KD) cardiomyocytes, as measured from . Signal intensities of acetylated-GSK3α and acetylated-GSK3β were measured by densitometry analysis (ImageJ software). n = 3. Data is presented as mean ± s.d. *p<0.05. Student’s t test was used to calculate the p values. ( C ) Histogram showing enzymatic activity of acetylated and deacetylated GSK3α. Recombinant HA- GSK3α was immunoprecipitated from HeLa cells overexpressing pcDNA-HA-GSK3α using HA-coupled agarose beads. Immunoprecipitated HA-GSK3α was acetylated by p300 in the presence of Acetyl-CoA (Ac-CoA) in HAT buffer. Acetylated GSK3α was further deacetylated by Flag-SIRT2 immunoprecipitated from HEK 293 T cells overexpressing plasmid encoding Flag-tagged SIRT2-WT using agarose beads conjugated to anti-Flag antibody (Sigma A2220). The enzymatic activity of GSK3α was measured against glycogen synthase (GS)-peptide. n = 5. Data is presented as mean ± s.d. *p<0.05. One-way ANOVA was used to calculate the p values. ( D ) Annotation of representative tandem mass spectra of trypsin-digested GSK3α, depicting K99, K246 acetylation. ( E ) Protein sequence alignment of the modeled region of GSK3α and the structure of GSK3β. ( F ) Cartoon, surface representation of the homology model of GSK3α (highlighted is the adenine nucleotide-binding pocket and position of K246 residue).

Article Snippet: Transfected construct (human) , HA GSK3 beta K183Q pcDNA3 , Modified Addgene, plasmid 14755 , This paper , For, gcaggttctgcggctgaatatcgcgatggcaaatgccaaag; Rev, ctttggcatttgccatcgcgatattcagccgcagaacctgc;.

Techniques: Western Blot, Control, Transfection, Immunoprecipitation, Software, Activity Assay, Recombinant, Plasmid Preparation, Sequencing, Binding Assay, Residue

( A ) Western blotting analysis depicting the activity of GSK3 inhibitor X (GSK3-X). Neonatal rat cardiomyocytes were treated with vehicle or 500 nM GSK3-X for 48 hr and the activity of GSK3 was assessed by monitoring the phosphorylation of GS by specific antibody. ( B ) [ 3 H]-leucine incorporation into total cellular protein of control (Ad-GFP) or SIRT2-overexpressing (Ad-SIRT2) rat neonatal cardiomyocytes treated with either vehicle or 500 nM GSK3 inhibitor X (GSK3-X) for 48 hr. Cardiomyocytes were infected with adenoviral vectors encoding either GFP or SIRT2 for 24 hr prior to GSK3-X treatment. After the GSK3-X treatment, cardiomyocytes were stimulated with either vehicle or 20 µM ISO for 24 hr and the [ 3 H]-leucine incorporation was monitored. c.p.m. counts per minute. n = 10. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. ( C ) Histogram showing quantification of relative cardiomyocyte area in control (Ad-Null) and SIRT2-overexpressing (Ad-SIRT2) rat neonatal cardiomyocytes treated with either vehicle or 500 nM GSK3 inhibitor X (GSK3-X) for 48 hr. Cardiomyocytes were infected with adenoviral vectors encoding either control or SIRT2 for 24 hr prior to GSK3-X treatment. After the GSK3-X treatment, cardiomyocytes were stimulated with either vehicle or 20 µM ISO for 24 hr and the relative cardiomyocyte area is quantified as described in Materials and methods section. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. ( D ) Representative confocal images depicting perinuclear expression of ANP in control (Ad-Null) or SIRT2-overexpressing (Ad-SIRT2) cardiomyocytes treated with either vehicle or ISO (20 µM, 24 hr), with or without GSK3 inhibitor X (GSK3-X, 500 nM, 48 hr). Scale bar = 20 µm. ANP (Green), Myomesin (Red), Hoechst (Blue). ( E ) Western blotting analysis for puromycin incorporation in control or SIRT2-depleted (SIRT2-KD) neonatal rat cardiomyocytes infected with adenovirus expressing either control (Ad-luc shRNA) or p300 shRNA (Ad-p300-shRNA) 48 hr. p300 depletion was confirmed by western blotting. Pulse of puromycin was given 30 min prior to harvesting of cardiomyocytes and puromycin incorporation into nascent proteins was tested using anti-puromycin antibody. # marked Western images denotes SIRT2 antibody used in this assay detects single band. ( F ) Histogram showing relative puromycin levels in control or SIRT2-depleted (SIRT2-KD) cardiomyocytes infected with adenovirus expressing either control (Ad-luc shRNA) or p300 shRNA (Ad-p300-shRNA). The data is generated from . Signal intensities of puromycin and actin were measured by densitometry analysis using ImageJ software. n = 3 independent experiments. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. ( G ) Western blotting analysis of GSK3β acetylation and activity in heart lysates of vehicle or anacardic acid (p300 inhibitor) treated 9 months old WT and SIRT2-KO mice littermates. Anacardic acid was injected intraperitoneal at the dose of 5 mg/kg/day for 10 days in mice. Peanut oil was used as vehicle. GSK3β was immunoprecipitated from heart lysates of WT and SIRT2-KO mice using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnology), and the affinity resin with protein A/G immobilized. Western blotting was performed to detect GSK3β acetylation by anti-Ac-Lysine antibody. GSK3β activity was measured by detecting the phosphorylation of GS. SIRT2 depletion was confirmed by western blotting. Whole cell lysates (WCL) was probed for indicated proteins by western blotting. ( H ) Histogram showing relative GSK3β acetylation in heart lysates of vehicle or anacardic acid (5 mg/kg/day for 10 days) treated 9 months old WT and SIRT2-KO mice from . n = 3. Signal intensities of GSK3β and acetylated-GSK3β was measured by densitometry analysis using ImageJ software. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. ( I ) Scatter plot depicting HW/TL ratio of 9 months old WT and SIRT2-KO mice treated with either vehicle or anacardic acid, (p300-INH), at the dose of 5 mg/kg/day for 10 days. n = 5 mice per group. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. ( J ) Scatter plot showing left ventricular posterior wall thickness of 9 months old WT and SIRT2-KO mice treated with either vehicle or anacardic acid (p300-INH), at the dose of 5 mg/kg/day for 10 days. n = 6–8 mice per group. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. ( K ) Scatter plot depicting cardiac contractile functions, as measured by ejection fraction of 9 months old WT and SIRT2-KO mice treated with either vehicle or anacardic acid (p300-INH), at the dose of 5 mg/kg/day for 10 days. n = 6–8 mice per group. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values.

Journal: eLife

Article Title: SIRT2 deacetylase regulates the activity of GSK3 isoforms independent of inhibitory phosphorylation

doi: 10.7554/eLife.32952

Figure Lengend Snippet: ( A ) Western blotting analysis depicting the activity of GSK3 inhibitor X (GSK3-X). Neonatal rat cardiomyocytes were treated with vehicle or 500 nM GSK3-X for 48 hr and the activity of GSK3 was assessed by monitoring the phosphorylation of GS by specific antibody. ( B ) [ 3 H]-leucine incorporation into total cellular protein of control (Ad-GFP) or SIRT2-overexpressing (Ad-SIRT2) rat neonatal cardiomyocytes treated with either vehicle or 500 nM GSK3 inhibitor X (GSK3-X) for 48 hr. Cardiomyocytes were infected with adenoviral vectors encoding either GFP or SIRT2 for 24 hr prior to GSK3-X treatment. After the GSK3-X treatment, cardiomyocytes were stimulated with either vehicle or 20 µM ISO for 24 hr and the [ 3 H]-leucine incorporation was monitored. c.p.m. counts per minute. n = 10. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. ( C ) Histogram showing quantification of relative cardiomyocyte area in control (Ad-Null) and SIRT2-overexpressing (Ad-SIRT2) rat neonatal cardiomyocytes treated with either vehicle or 500 nM GSK3 inhibitor X (GSK3-X) for 48 hr. Cardiomyocytes were infected with adenoviral vectors encoding either control or SIRT2 for 24 hr prior to GSK3-X treatment. After the GSK3-X treatment, cardiomyocytes were stimulated with either vehicle or 20 µM ISO for 24 hr and the relative cardiomyocyte area is quantified as described in Materials and methods section. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. ( D ) Representative confocal images depicting perinuclear expression of ANP in control (Ad-Null) or SIRT2-overexpressing (Ad-SIRT2) cardiomyocytes treated with either vehicle or ISO (20 µM, 24 hr), with or without GSK3 inhibitor X (GSK3-X, 500 nM, 48 hr). Scale bar = 20 µm. ANP (Green), Myomesin (Red), Hoechst (Blue). ( E ) Western blotting analysis for puromycin incorporation in control or SIRT2-depleted (SIRT2-KD) neonatal rat cardiomyocytes infected with adenovirus expressing either control (Ad-luc shRNA) or p300 shRNA (Ad-p300-shRNA) 48 hr. p300 depletion was confirmed by western blotting. Pulse of puromycin was given 30 min prior to harvesting of cardiomyocytes and puromycin incorporation into nascent proteins was tested using anti-puromycin antibody. # marked Western images denotes SIRT2 antibody used in this assay detects single band. ( F ) Histogram showing relative puromycin levels in control or SIRT2-depleted (SIRT2-KD) cardiomyocytes infected with adenovirus expressing either control (Ad-luc shRNA) or p300 shRNA (Ad-p300-shRNA). The data is generated from . Signal intensities of puromycin and actin were measured by densitometry analysis using ImageJ software. n = 3 independent experiments. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. ( G ) Western blotting analysis of GSK3β acetylation and activity in heart lysates of vehicle or anacardic acid (p300 inhibitor) treated 9 months old WT and SIRT2-KO mice littermates. Anacardic acid was injected intraperitoneal at the dose of 5 mg/kg/day for 10 days in mice. Peanut oil was used as vehicle. GSK3β was immunoprecipitated from heart lysates of WT and SIRT2-KO mice using anti-GSK3β antibody (sc-9166, Santa Cruz Biotechnology), and the affinity resin with protein A/G immobilized. Western blotting was performed to detect GSK3β acetylation by anti-Ac-Lysine antibody. GSK3β activity was measured by detecting the phosphorylation of GS. SIRT2 depletion was confirmed by western blotting. Whole cell lysates (WCL) was probed for indicated proteins by western blotting. ( H ) Histogram showing relative GSK3β acetylation in heart lysates of vehicle or anacardic acid (5 mg/kg/day for 10 days) treated 9 months old WT and SIRT2-KO mice from . n = 3. Signal intensities of GSK3β and acetylated-GSK3β was measured by densitometry analysis using ImageJ software. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. ( I ) Scatter plot depicting HW/TL ratio of 9 months old WT and SIRT2-KO mice treated with either vehicle or anacardic acid, (p300-INH), at the dose of 5 mg/kg/day for 10 days. n = 5 mice per group. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. ( J ) Scatter plot showing left ventricular posterior wall thickness of 9 months old WT and SIRT2-KO mice treated with either vehicle or anacardic acid (p300-INH), at the dose of 5 mg/kg/day for 10 days. n = 6–8 mice per group. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. ( K ) Scatter plot depicting cardiac contractile functions, as measured by ejection fraction of 9 months old WT and SIRT2-KO mice treated with either vehicle or anacardic acid (p300-INH), at the dose of 5 mg/kg/day for 10 days. n = 6–8 mice per group. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values.

Article Snippet: Transfected construct (human) , HA GSK3 beta K183Q pcDNA3 , Modified Addgene, plasmid 14755 , This paper , For, gcaggttctgcggctgaatatcgcgatggcaaatgccaaag; Rev, ctttggcatttgccatcgcgatattcagccgcagaacctgc;.

Techniques: Western Blot, Activity Assay, Phospho-proteomics, Control, Infection, Expressing, shRNA, Generated, Software, Injection, Immunoprecipitation

( A ) Western blotting analysis to confirm the activity of LiCl. Neonatal rat cardiomyocytes were treated with 20 mM LiCl for 48 hr and the activity of GSK3β was assessed by monitoring the phosphorylation of p-GS. ( B ) [ 3 H]-leucine incorporation into total cellular protein of control (Ad-GFP) or SIRT2-overexpressing (Ad-SIRT2) rat neonatal cardiomyocytes treated either with vehicle or ISO (20 µM, 24 hr), with or without LiCl (20 mM, 48 hr). c.p.m. counts per minute. n = 10. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. ( C ) Histogram showing quantification of relative cardiomyocyte area in control (Ad-Null) or SIRT2-overexpressing (Ad-SIRT2) rat neonatal cardiomyocytes treated either with vehicle or ISO (20 µM, 24 hr), with or without LiCl (20 mM, 48 hr). Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. ( D ) Representative confocal images depicting perinuclear expression ANP in control (Ad-Null) or SIRT2-overexpressing (Ad-SIRT2) rat neonatal cardiomyocytes treated either with vehicle or ISO (20 µM, 24 hr), with or without 20 mM LiCl. Scale bar = 20 µm. α- Actinin (Green), ANP (Red) and Hoechst (Blue).

Journal: eLife

Article Title: SIRT2 deacetylase regulates the activity of GSK3 isoforms independent of inhibitory phosphorylation

doi: 10.7554/eLife.32952

Figure Lengend Snippet: ( A ) Western blotting analysis to confirm the activity of LiCl. Neonatal rat cardiomyocytes were treated with 20 mM LiCl for 48 hr and the activity of GSK3β was assessed by monitoring the phosphorylation of p-GS. ( B ) [ 3 H]-leucine incorporation into total cellular protein of control (Ad-GFP) or SIRT2-overexpressing (Ad-SIRT2) rat neonatal cardiomyocytes treated either with vehicle or ISO (20 µM, 24 hr), with or without LiCl (20 mM, 48 hr). c.p.m. counts per minute. n = 10. Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. ( C ) Histogram showing quantification of relative cardiomyocyte area in control (Ad-Null) or SIRT2-overexpressing (Ad-SIRT2) rat neonatal cardiomyocytes treated either with vehicle or ISO (20 µM, 24 hr), with or without LiCl (20 mM, 48 hr). Data is presented as mean ± s.d. *p<0.05. Two-way ANOVA was used to calculate the p values. ( D ) Representative confocal images depicting perinuclear expression ANP in control (Ad-Null) or SIRT2-overexpressing (Ad-SIRT2) rat neonatal cardiomyocytes treated either with vehicle or ISO (20 µM, 24 hr), with or without 20 mM LiCl. Scale bar = 20 µm. α- Actinin (Green), ANP (Red) and Hoechst (Blue).

Article Snippet: Transfected construct (human) , HA GSK3 beta K183Q pcDNA3 , Modified Addgene, plasmid 14755 , This paper , For, gcaggttctgcggctgaatatcgcgatggcaaatgccaaag; Rev, ctttggcatttgccatcgcgatattcagccgcagaacctgc;.

Techniques: Western Blot, Activity Assay, Phospho-proteomics, Control, Expressing

Journal: eLife

Article Title: SIRT2 deacetylase regulates the activity of GSK3 isoforms independent of inhibitory phosphorylation

doi: 10.7554/eLife.32952

Figure Lengend Snippet:

Article Snippet: Transfected construct (human) , HA GSK3 beta K183Q pcDNA3 , Modified Addgene, plasmid 14755 , This paper , For, gcaggttctgcggctgaatatcgcgatggcaaatgccaaag; Rev, ctttggcatttgccatcgcgatattcagccgcagaacctgc;.

Techniques: Knock-Out, Western Blot, Agarose Gel Electrophoresis, Produced, Transfection, Construct, Plasmid Preparation, Modification, Infection, Recombinant, Sequencing, Activity Assay, Mutagenesis, Protease Inhibitor, Microscopy, Software, Membrane, Cell Culture

SKP2 is a FASN target in human HCC cell lines. ( A ) The HLF, MHCC97-H, Hep3B, HuH7, and SNU449 cell lines were subjected to FASN knockdown using a specific small interfering siRNA against FASN (si-FASN). Data were collected 48 h after the silencing. The effects of FASN silencing on FASN, SKP2, and p27 KIP1 protein levels were detected by Western blot analysis. β-Actin was used as a loading control. ( B ) The effects of FASN silencing in the same cell lines on FASN , SKP2 , and CDKN1B (encoding p27 KIP1 ) mRNA levels were detected by quantitative real-time PCR. Student’s t -test: p < 0.0001 *** vs. scramble siRNA (Scr). Experiments were conducted three times in triplicate.

Journal: Medicina

Article Title: Fatty Acid Synthase Promotes Hepatocellular Carcinoma Growth via S-Phase Kinase-Associated Protein 2/p27 KIP1 Regulation

doi: 10.3390/medicina60071160

Figure Lengend Snippet: SKP2 is a FASN target in human HCC cell lines. ( A ) The HLF, MHCC97-H, Hep3B, HuH7, and SNU449 cell lines were subjected to FASN knockdown using a specific small interfering siRNA against FASN (si-FASN). Data were collected 48 h after the silencing. The effects of FASN silencing on FASN, SKP2, and p27 KIP1 protein levels were detected by Western blot analysis. β-Actin was used as a loading control. ( B ) The effects of FASN silencing in the same cell lines on FASN , SKP2 , and CDKN1B (encoding p27 KIP1 ) mRNA levels were detected by quantitative real-time PCR. Student’s t -test: p < 0.0001 *** vs. scramble siRNA (Scr). Experiments were conducted three times in triplicate.

Article Snippet: Gene Expression Assays for human FASN (Hs01005622_m1), SKP2 (Hs01021864_m1), CDKN1B (Hs00153277_m1), and β-actin (4333762T), and mouse Fasn (Mm00662319_m1), Skp2 (Mm00449925_m1), Cdkn1b (Mm00438168_m1) and β-actin (mm00607939_S1) were from Applied Biosystems (Foster City, CA, USA).

Techniques: Knockdown, Western Blot, Control, Real-time Polymerase Chain Reaction

SKP2 is induced in the liver lesions from AKT mice. ( A , B ) Hydrodynamic gene delivery approach. In brief, FASN fl/fl mice were either injected with the myr-AKT1 construct (AKT mice) ( A ) or co-injected with Myr-AKT1 and Cre recombinase plasmids (AKT/Cre mice) ( B ). Five mice per group were injected and sacrificed 32 weeks post-injection (w.p.i.). ( C ) Immunohistochemical analysis shows that hepatocellular tumor lesions (T) developed in AKT mice display robust immunoreactivity for FASN, HA-AKT, and SKP2 proteins. Note that in the tumor cells, the immunoreactivity for SKP2 is localized in the cytoplasmic and nuclear compartments, as appreciable at the 200× magnification. In contrast, the surrounding non-tumorous liver tissues (ST) show weak/absent staining for the same proteins. Abbreviation: H&E, hematoxylin and eosin staining. Original magnifications: 100× and 200×, as indicated. Scale bar: 100 µm in 100× magnification pictures, 50 µm in the 200× magnification picture. ( D ) Representative Western blot analysis showing the levels of FASN, SKP2, and p27KIP1 in livers from FASN fl/fl mice injected with the empty vector only (Control), Myr-AKT1 (AKT mice), and myr-AKT1/Cre (AKT/Cre mice). Note that AKT mice display upregulation of SKP2 and marked downregulation of p27 KIP1 . Suppression of FASN in AKT/Cre mice, which triggers the inhibition of hepatocarcinogenesis, is accompanied by downregulation of SKP2 and an increase of p27 KIP1 protein levels. β-Actin was used as a loading control. ( E ) Quantitative real-time RT-PCR showing the mRNA levels of Fasn , Skp2 , and Cdkn1b in livers from FASN fl/fl mice injected with the empty vector only (vector), Myr-AKT1 (AKT mice) and myr-AKT1/Cre (AKT/Cre mice). N target = 2 −ΔCt , wherein the ΔCt value of each sample was calculated by subtracting the average Ct value of the target gene from the average Ct value of the β- actin gene. Five mice per group were analyzed. Tukey–Kramer’s test: p < 0.0001; a , versus control livers (vector); b , versus AKT livers.

Journal: Medicina

Article Title: Fatty Acid Synthase Promotes Hepatocellular Carcinoma Growth via S-Phase Kinase-Associated Protein 2/p27 KIP1 Regulation

doi: 10.3390/medicina60071160

Figure Lengend Snippet: SKP2 is induced in the liver lesions from AKT mice. ( A , B ) Hydrodynamic gene delivery approach. In brief, FASN fl/fl mice were either injected with the myr-AKT1 construct (AKT mice) ( A ) or co-injected with Myr-AKT1 and Cre recombinase plasmids (AKT/Cre mice) ( B ). Five mice per group were injected and sacrificed 32 weeks post-injection (w.p.i.). ( C ) Immunohistochemical analysis shows that hepatocellular tumor lesions (T) developed in AKT mice display robust immunoreactivity for FASN, HA-AKT, and SKP2 proteins. Note that in the tumor cells, the immunoreactivity for SKP2 is localized in the cytoplasmic and nuclear compartments, as appreciable at the 200× magnification. In contrast, the surrounding non-tumorous liver tissues (ST) show weak/absent staining for the same proteins. Abbreviation: H&E, hematoxylin and eosin staining. Original magnifications: 100× and 200×, as indicated. Scale bar: 100 µm in 100× magnification pictures, 50 µm in the 200× magnification picture. ( D ) Representative Western blot analysis showing the levels of FASN, SKP2, and p27KIP1 in livers from FASN fl/fl mice injected with the empty vector only (Control), Myr-AKT1 (AKT mice), and myr-AKT1/Cre (AKT/Cre mice). Note that AKT mice display upregulation of SKP2 and marked downregulation of p27 KIP1 . Suppression of FASN in AKT/Cre mice, which triggers the inhibition of hepatocarcinogenesis, is accompanied by downregulation of SKP2 and an increase of p27 KIP1 protein levels. β-Actin was used as a loading control. ( E ) Quantitative real-time RT-PCR showing the mRNA levels of Fasn , Skp2 , and Cdkn1b in livers from FASN fl/fl mice injected with the empty vector only (vector), Myr-AKT1 (AKT mice) and myr-AKT1/Cre (AKT/Cre mice). N target = 2 −ΔCt , wherein the ΔCt value of each sample was calculated by subtracting the average Ct value of the target gene from the average Ct value of the β- actin gene. Five mice per group were analyzed. Tukey–Kramer’s test: p < 0.0001; a , versus control livers (vector); b , versus AKT livers.

Article Snippet: Gene Expression Assays for human FASN (Hs01005622_m1), SKP2 (Hs01021864_m1), CDKN1B (Hs00153277_m1), and β-actin (4333762T), and mouse Fasn (Mm00662319_m1), Skp2 (Mm00449925_m1), Cdkn1b (Mm00438168_m1) and β-actin (mm00607939_S1) were from Applied Biosystems (Foster City, CA, USA).

Techniques: Injection, Construct, Immunohistochemical staining, Staining, Western Blot, Plasmid Preparation, Control, Inhibition, Quantitative RT-PCR

SKP2 inactivation or non-degradable p27 KIP1 suppresses AKT-dependent hepatocarcinogenesis in mice. In the upper panels, the hydrodynamic gene delivery approach is depicted. In brief, C57BL/6J mice were either co-injected with the HA-tagged myr-AKT1 and empty vector (AKT mice), with Myr-AKT1 and SKP2 dominant negative (AKT/SKP2dn mice), or with Myr-AKT1 and a non-degradable form of V5-tagged p27 KIP1 (p27 KIP1-T187A ; AKT/p27 KIP1 mice). Five mice per group were injected and sacrificed 32 weeks post-injection (w.p.i.). At this time point, as revealed by hematoxylin and eosin staining (H&E), the livers of AKT mice are occupied by several tumor nodules (T). In contrast, the livers of AKT/SKP2dn and AKT/p27 KIP1 mice appear completely normal (better appreciable in the pictures taken at higher magnification). Original magnifications: 40× and 100×. Scale bar: 500 µm in 40× magnification pictures, 200 µm in 100× magnification pictures.

Journal: Medicina

Article Title: Fatty Acid Synthase Promotes Hepatocellular Carcinoma Growth via S-Phase Kinase-Associated Protein 2/p27 KIP1 Regulation

doi: 10.3390/medicina60071160

Figure Lengend Snippet: SKP2 inactivation or non-degradable p27 KIP1 suppresses AKT-dependent hepatocarcinogenesis in mice. In the upper panels, the hydrodynamic gene delivery approach is depicted. In brief, C57BL/6J mice were either co-injected with the HA-tagged myr-AKT1 and empty vector (AKT mice), with Myr-AKT1 and SKP2 dominant negative (AKT/SKP2dn mice), or with Myr-AKT1 and a non-degradable form of V5-tagged p27 KIP1 (p27 KIP1-T187A ; AKT/p27 KIP1 mice). Five mice per group were injected and sacrificed 32 weeks post-injection (w.p.i.). At this time point, as revealed by hematoxylin and eosin staining (H&E), the livers of AKT mice are occupied by several tumor nodules (T). In contrast, the livers of AKT/SKP2dn and AKT/p27 KIP1 mice appear completely normal (better appreciable in the pictures taken at higher magnification). Original magnifications: 40× and 100×. Scale bar: 500 µm in 40× magnification pictures, 200 µm in 100× magnification pictures.

Article Snippet: Gene Expression Assays for human FASN (Hs01005622_m1), SKP2 (Hs01021864_m1), CDKN1B (Hs00153277_m1), and β-actin (4333762T), and mouse Fasn (Mm00662319_m1), Skp2 (Mm00449925_m1), Cdkn1b (Mm00438168_m1) and β-actin (mm00607939_S1) were from Applied Biosystems (Foster City, CA, USA).

Techniques: Injection, Plasmid Preparation, Dominant Negative Mutation, Staining

Inactivation of SKP2 or non-degradable p27 KIP1 is detrimental to the growth of HCC cells in vitro. ( A ) Transfection of SKP2dn triggers the upregulation of p27 KIP1 levels in SNU449 cells, as detected by Western blot analysis. As expected, transient transfection of SKP2dn resulted in the expression of a truncated form of SKP2 (transfected) with a lower molecular weight than the endogenous protein. β-Actin was used as a loading control. Transfection of SKP2dn reduces proliferation ( B ) and increases apoptosis ( C ) in the same cells. ( D ) Transfection of p27 KIP1−187A results in the appearance of a second band (transfected) with a higher molecular weight than the endogenous p27 KIP1 protein in the SNU449 cell line. β-Actin was used as a loading control. Similar to that described for SKP2dn, transfection of p27 KIP1−187A decreases proliferation ( E ) and augments apoptosis ( F ) in the same cell line. Student’s t -test: p < 0.0001 *** vs. empty vector (control). Experiments were conducted three times in triplicate.

Journal: Medicina

Article Title: Fatty Acid Synthase Promotes Hepatocellular Carcinoma Growth via S-Phase Kinase-Associated Protein 2/p27 KIP1 Regulation

doi: 10.3390/medicina60071160

Figure Lengend Snippet: Inactivation of SKP2 or non-degradable p27 KIP1 is detrimental to the growth of HCC cells in vitro. ( A ) Transfection of SKP2dn triggers the upregulation of p27 KIP1 levels in SNU449 cells, as detected by Western blot analysis. As expected, transient transfection of SKP2dn resulted in the expression of a truncated form of SKP2 (transfected) with a lower molecular weight than the endogenous protein. β-Actin was used as a loading control. Transfection of SKP2dn reduces proliferation ( B ) and increases apoptosis ( C ) in the same cells. ( D ) Transfection of p27 KIP1−187A results in the appearance of a second band (transfected) with a higher molecular weight than the endogenous p27 KIP1 protein in the SNU449 cell line. β-Actin was used as a loading control. Similar to that described for SKP2dn, transfection of p27 KIP1−187A decreases proliferation ( E ) and augments apoptosis ( F ) in the same cell line. Student’s t -test: p < 0.0001 *** vs. empty vector (control). Experiments were conducted three times in triplicate.

Article Snippet: Gene Expression Assays for human FASN (Hs01005622_m1), SKP2 (Hs01021864_m1), CDKN1B (Hs00153277_m1), and β-actin (4333762T), and mouse Fasn (Mm00662319_m1), Skp2 (Mm00449925_m1), Cdkn1b (Mm00438168_m1) and β-actin (mm00607939_S1) were from Applied Biosystems (Foster City, CA, USA).

Techniques: In Vitro, Transfection, Western Blot, Expressing, Molecular Weight, Control, Plasmid Preparation

HepG2 cells were treated with applied concentrations of liposomal C8 for indicated time, expressions of indicated proteins were tested Western blots (A). HepG2 cells, pretreated with JNK inhibitor IX (“JNKi”, 0.25 μM) or SP600125 (“SP”, 5 μM) for 1 h, were treated with liposomal C8 (10 μM), cell proliferation (B) and apoptosis (C) were tested. Control HepG2 cells, or the stable HepG2 cells expressing dominant negative JNK1 (“dn-JNK1”) or empty vector (pSuper), were treated with liposomal C8 (10 μM) for applied time, Western blots were utilized to test the signaling changes (D), cell proliferation (E) and cell apoptosis (F) were also tested. Control HepG2 cells, as well as stable HepG2 cells expressing scramble control shRNA (“sc-shRNA”) or ASK1-shRNA were treated with liposomal C8 (10 μM) for applied time, signaling changes (G), cell proliferation (H) and apoptosis (I) were tested as described. Expressions of listed proteins were quantified (A, D and G, a total of three repeats). Data represent the means of three independent experiments ± SD. The asterisks (*) indicate statistically significant differences compared to “C” group. # indicates statistically significant differences compared to liposomal C8 only group of “no shRNA” or “Vector” group.

Journal: PLoS ONE

Article Title: Preclinical Evaluation of Liposomal C8 Ceramide as a Potent anti-Hepatocellular Carcinoma Agent

doi: 10.1371/journal.pone.0145195

Figure Lengend Snippet: HepG2 cells were treated with applied concentrations of liposomal C8 for indicated time, expressions of indicated proteins were tested Western blots (A). HepG2 cells, pretreated with JNK inhibitor IX (“JNKi”, 0.25 μM) or SP600125 (“SP”, 5 μM) for 1 h, were treated with liposomal C8 (10 μM), cell proliferation (B) and apoptosis (C) were tested. Control HepG2 cells, or the stable HepG2 cells expressing dominant negative JNK1 (“dn-JNK1”) or empty vector (pSuper), were treated with liposomal C8 (10 μM) for applied time, Western blots were utilized to test the signaling changes (D), cell proliferation (E) and cell apoptosis (F) were also tested. Control HepG2 cells, as well as stable HepG2 cells expressing scramble control shRNA (“sc-shRNA”) or ASK1-shRNA were treated with liposomal C8 (10 μM) for applied time, signaling changes (G), cell proliferation (H) and apoptosis (I) were tested as described. Expressions of listed proteins were quantified (A, D and G, a total of three repeats). Data represent the means of three independent experiments ± SD. The asterisks (*) indicate statistically significant differences compared to “C” group. # indicates statistically significant differences compared to liposomal C8 only group of “no shRNA” or “Vector” group.

Article Snippet: The two JNK (Jun N-terminal protein kinase) inhibitors, SP600125 and JNK inhibitor IX (JNKi-IX), were purchased from Selleck (Shanghai, China). p-AKT (Ser 473) antibody (9271), AKT1 antibody (2938), p-S6 ribosomal protein (S6, Ser 235/236) antibody (2211), S6 antibody (2317), p-p70 S6 kinase 1 (S6K1, Thr 398) antibody (9209), S6K1 antibody (9202), p-SAPK/JNK1 (Thr183/Tyr185) antibody (9251), Jun N-terminal protein kinase (JNK1) antibody (3708), p-ASK1 (Thr 845) antibody (3765), ASK1 antibody (3762), cyclin D1 antibody (2922), HIF-1α antibody (3716), c-Jun antibody (9165) and (β-)Tubulin (D2N5G) antibody (15115), cleaved-caspase-3 antibody (9661) and β-actin antibody (3700) were all purchased from Cell Signaling Tech. (Beverly, MA).

Techniques: Western Blot, Control, Expressing, Dominant Negative Mutation, Plasmid Preparation, shRNA

A Crystal violent staining under microscopy of MKN1 NTC cells, ILK knock-out single-cell clone #1 and #18 with SA-β-Gal staining respectively. Scale bar, 50 μm. B F-actin (red)/DAPI (blue) and ZO-1 (green) staining of three selected clones. Scale bar, 25 μm. C The percentage of cells with positive staining for SA-β-Gal from A . D Quantification of F-actin and ZO-1 fluorescent intensity from B . E Flow cytometry analysis of cell size from indicated clones. F Western blot analysis of several cell cycle-related proteins in the lysate of the three clones, with GAPDH as the loading control. G Representative pairs of low power (left, solid line) and high power (right, dotted line) photomicrographs images of xenografic tumors that were subjected to SA-β-Gal, p21, p16, p53 and p-γH2AX staining were shown. Scale bar, 200 μm (solid line), 100 μm (dotted line). Arrows, nucleus-staining zone. H The percentage of cells stained positively in the field for SA-β-Gal, p21, p16, p53, and p-γH2AX were shown by IHC scores. Data represent the mean ± SD of at least three independent experiments. * p < 0.05, ** p < 0.01 and *** p < 0.001.

Journal: Cell Death & Disease

Article Title: The kinase activity of integrin-linked kinase regulates cellular senescence in gastric cancer

doi: 10.1038/s41419-022-05020-3

Figure Lengend Snippet: A Crystal violent staining under microscopy of MKN1 NTC cells, ILK knock-out single-cell clone #1 and #18 with SA-β-Gal staining respectively. Scale bar, 50 μm. B F-actin (red)/DAPI (blue) and ZO-1 (green) staining of three selected clones. Scale bar, 25 μm. C The percentage of cells with positive staining for SA-β-Gal from A . D Quantification of F-actin and ZO-1 fluorescent intensity from B . E Flow cytometry analysis of cell size from indicated clones. F Western blot analysis of several cell cycle-related proteins in the lysate of the three clones, with GAPDH as the loading control. G Representative pairs of low power (left, solid line) and high power (right, dotted line) photomicrographs images of xenografic tumors that were subjected to SA-β-Gal, p21, p16, p53 and p-γH2AX staining were shown. Scale bar, 200 μm (solid line), 100 μm (dotted line). Arrows, nucleus-staining zone. H The percentage of cells stained positively in the field for SA-β-Gal, p21, p16, p53, and p-γH2AX were shown by IHC scores. Data represent the mean ± SD of at least three independent experiments. * p < 0.05, ** p < 0.01 and *** p < 0.001.

Article Snippet: Immunohistochemistry staining (IHC) was performed with primary antibodies against p-γH2AX (1:450 dilution), ILK (1:100 dilution) (Cell Signaling Technology), p21 Waf1/Cip1 (1:200 dilution), p16 INK4A (1:200 dilution), Amphiphysin (1:200 dilution) (Proteintech), PCNA (1:2000 dilution), and p53 (1:500 dilution) (Servicebio), along with concentration matched isotype control (Cell Signaling Technology).

Techniques: Staining, Microscopy, Knock-Out, Clone Assay, Flow Cytometry, Western Blot, Control

A V2-tagged ILK variants were transfected into MKN1 cells. They are ILK constructs lacking the four ankyrin repeats (ΔANK), the catalytic domain (Δ1–213), integrin binding region (Δ1–293), as well as the dominant negative ILK mutant (R211A), ILK with disrupted catalytic function (K220M) and a mutant deficient for β-parvin binding (E359K). B Representative images of EdU assay were shown with the MKN1 NTC and ILK-KO transfected with different ILK mutants and truncations. Scale bar, 100 μm. Quantification of EdU positive cells was displayed in C . D Representative images of SA-β-Gal staining of MKN1 NTC and ILK-KO transfected with empty, different ILK mutants and truncations. Scale bar, 50 μm. Quantification of the percentage of cells with positive staining for SA-β-Gal was displayed in E . F Cell lysates were analyzed by western blotting using antibodies to p21 and p16 with GAPDH as the loading control. Data represent the mean ± SD of at least three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Cell Death & Disease

Article Title: The kinase activity of integrin-linked kinase regulates cellular senescence in gastric cancer

doi: 10.1038/s41419-022-05020-3

Figure Lengend Snippet: A V2-tagged ILK variants were transfected into MKN1 cells. They are ILK constructs lacking the four ankyrin repeats (ΔANK), the catalytic domain (Δ1–213), integrin binding region (Δ1–293), as well as the dominant negative ILK mutant (R211A), ILK with disrupted catalytic function (K220M) and a mutant deficient for β-parvin binding (E359K). B Representative images of EdU assay were shown with the MKN1 NTC and ILK-KO transfected with different ILK mutants and truncations. Scale bar, 100 μm. Quantification of EdU positive cells was displayed in C . D Representative images of SA-β-Gal staining of MKN1 NTC and ILK-KO transfected with empty, different ILK mutants and truncations. Scale bar, 50 μm. Quantification of the percentage of cells with positive staining for SA-β-Gal was displayed in E . F Cell lysates were analyzed by western blotting using antibodies to p21 and p16 with GAPDH as the loading control. Data represent the mean ± SD of at least three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: Immunohistochemistry staining (IHC) was performed with primary antibodies against p-γH2AX (1:450 dilution), ILK (1:100 dilution) (Cell Signaling Technology), p21 Waf1/Cip1 (1:200 dilution), p16 INK4A (1:200 dilution), Amphiphysin (1:200 dilution) (Proteintech), PCNA (1:2000 dilution), and p53 (1:500 dilution) (Servicebio), along with concentration matched isotype control (Cell Signaling Technology).

Techniques: Transfection, Construct, Binding Assay, Dominant Negative Mutation, Mutagenesis, EdU Assay, Staining, Western Blot, Control

A Representative images of SA-β-Gal staining were shown with various concentrations of the ILK kinase inhibitor, Cpd22 for 5 days. Scale bar, 50 μm. Quantification of positive cells for the SA-β-Gal assay in A was displayed in B . C Representative images of EdU assay were shown as the dosage of Cpd22 treatment indicated. Scale bar, 100 μm. Quantification of EdU positive staining in C was displayed in D . E MKN1 was treated with Cpd22 as indicated for 5 days. Cell lysates were then harvested and immunoblotted for p-Akt (Ser473), p-GSK3β (Ser9), p21 and p16, with GAPDH as the loading control. F Representative images of FAs (Vinculin stained) and actin bundles (red) in MKN1 cells incubated with DMSO vehicle or 250 nM Cpd22 for 5 days. Arrows, vinculin-positive zone. Scale bar, 10 μm. Quantification of number of G FAs and H intensity of actin bundles. n ≥ 50 cells per group from three independent experiments. Data represent the mean ± SD of at least three independent experiments. ** p < 0.01.

Journal: Cell Death & Disease

Article Title: The kinase activity of integrin-linked kinase regulates cellular senescence in gastric cancer

doi: 10.1038/s41419-022-05020-3

Figure Lengend Snippet: A Representative images of SA-β-Gal staining were shown with various concentrations of the ILK kinase inhibitor, Cpd22 for 5 days. Scale bar, 50 μm. Quantification of positive cells for the SA-β-Gal assay in A was displayed in B . C Representative images of EdU assay were shown as the dosage of Cpd22 treatment indicated. Scale bar, 100 μm. Quantification of EdU positive staining in C was displayed in D . E MKN1 was treated with Cpd22 as indicated for 5 days. Cell lysates were then harvested and immunoblotted for p-Akt (Ser473), p-GSK3β (Ser9), p21 and p16, with GAPDH as the loading control. F Representative images of FAs (Vinculin stained) and actin bundles (red) in MKN1 cells incubated with DMSO vehicle or 250 nM Cpd22 for 5 days. Arrows, vinculin-positive zone. Scale bar, 10 μm. Quantification of number of G FAs and H intensity of actin bundles. n ≥ 50 cells per group from three independent experiments. Data represent the mean ± SD of at least three independent experiments. ** p < 0.01.

Article Snippet: Immunohistochemistry staining (IHC) was performed with primary antibodies against p-γH2AX (1:450 dilution), ILK (1:100 dilution) (Cell Signaling Technology), p21 Waf1/Cip1 (1:200 dilution), p16 INK4A (1:200 dilution), Amphiphysin (1:200 dilution) (Proteintech), PCNA (1:2000 dilution), and p53 (1:500 dilution) (Servicebio), along with concentration matched isotype control (Cell Signaling Technology).

Techniques: Staining, EdU Assay, Control, Incubation